Introduction

Increasing evidence in both experimental and clinical studies suggests that there is a close link between oxidative stress, impaired mitochondrial function, and the pathogenesis of diabetes mellitus and its vascular complications <sup>[1Ceriello A. New insights on oxidative stress and diabetic complications may lead to a “causal” antioxidant therapy Diabetes Care 2003 ;  26 : 1589-1596 [cross-ref]

Cliquez ici pour aller à la section Références and 2Brownlee M. Biochemistry and molecular cell biology of diabetic complications Nature 2001 ;  414 : 813-820 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. Hyperglycaemia induces an overproduction of reactive oxygen species (ROS) and also attenuates antioxidative mechanisms contributing to a pro-oxidant state <sup>[3Ceriello A., Bortolotti N., Crescentini A., Motz E., Lizzio S., Russo A., et al. Antioxidant defences are reduced during the oral glucose tolerance test in normal and non-insulin-dependent diabetic subjects Eur J Clin Invest 1998 ;  28 : 329-333 [cross-ref]

Cliquez ici pour aller à la section Références, 4Nishikawa T., Edelstein D., Du X.L., Yamagishi S., Matsumura T., Kaneda Y., et al. Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage Nature 2000 ;  404 : 787-790

Cliquez ici pour aller à la section Références, 5Kiritoshi S., Nishikawa T., Sonoda K., Kukidome D., Senokuchi T., Matsuo T., et al. Reactive oxygen species from mitochondria induce cyclo-oxygenase-2 gene expression in human mesangial cells: potential role in diabetic nephropathy Diabetes 2003 ;  52 : 2570-2577 [cross-ref]

Cliquez ici pour aller à la section Références and 6Piconi L., Quagliaro L., Assaloni R., Da Ros R., Maier A., Zuodar G., et al. Constant and intermittent high glucose enhances endothelial cell apoptosis through mitochondrial superoxide overproduction Diabetes Metab Res Rev 2006 ;  22 : 198-203 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. ROS generated by mitochondria in response to hyperglycaemia induce protein, lipid and DNA modifications <sup>[7Dandona P., Thusu K., Cook S., Snyder B., Makowski J., Armstrong D., et al. Oxidative damage to DNA in diabetes mellitus Lancet 1996 ;  347 : 444-445 [cross-ref]

Cliquez ici pour aller à la section Références, 8Seghrouchni I., Drai J., Bannier E., Riviere J., Calmard P., Garcia I., et al. Oxidative stress parameters in type I, type II and insulin-treated type 2 diabetes mellitus; insulin treatment efficiency Clin Chim Acta 2002 ;  321 : 89-96 [cross-ref]

Cliquez ici pour aller à la section Références and 9Ceriello A., Mercuri F., Quagliaro L., Assaloni R., Motz E., Tonutti L., et al. Detection of nitrotyrosine in the diabetic plasma: evidence of oxidative stress Diabetologia 2001 ;  44 : 834-838

Cliquez ici pour aller à la section Références]</sup>. Mitochondrial DNA (mtDNA) is markedly vulnerable to oxidative stress, resulting in both qualitative and quantitative changes <sup>[10Bohr V.A., Anson R.M. DNA damage, mutation and fine structure DNA repair in aging Mutat Res 1995 ;  338 : 25-34 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. These changes can impair cell function and participate in the apoptosis mediated by hyperglycaemia that occurs in the target tissues found in late diabetic complications <sup>[11Vincent A.M., Brownlee M., Russell J.W. Oxidative stress and programmed cell death in diabetic neuropathy Ann N Y Acad Sci 2002 ;  959 : 368-383

Cliquez ici pour aller à la section Références and 12Kowluru R.A., Atasi L., Ho Y.S. Role of mitochondrial superoxide dismutase in the development of diabetic retinopathy Invest Ophthalmol Vis Sci 2006 ;  47 : 1594-1599 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>.

Apart from these target tissues (including the retina, kidney and peripheral nerves) in which late diabetic complications develop, peripheral white blood cells are also damaged by oxidative stress. These cells are more easily obtained, but have disadvantages such as having fewer mitochondria and an invariably low degree of heteroplasmy due to their rapid turnover. Nevertheless, the study of mitochondrial oxidative stress in peripheral white blood cells is of interest as a reflection of events taking place in the tissues targeted by diabetic complications. Moreover, the study of mitochondrial oxidative stress in the peripheral white blood cells is itself of interest. This is because diabetes is associated with an increased risk of infection and, therefore, it is possible that mitochondrial dysfunction in peripheral white blood cells could contribute to the abnormalities in adherence, chemotaxis, phagocytosis and intracellular killing reported in diabetic patients. Furthermore, the impaired mitochondrial machinery in peripheral blood cells could result in a more pro-inflammatory cytokine profile that contributes to the pathogenesis of diabetic complications <sup>[13Devary Y., Rosette C., DiDonato J.A., Karin M. NF-kappa B activation by ultraviolet light not dependent on a nuclear signal Science 1993 ;  261 : 1442-1445

Cliquez ici pour aller à la section Références, 14Mohan N., Meltz M.M. Induction of nuclear factor kB after low-dose ionizing radiation involves a reactive oxygen intermediate signaling pathway Radiat Res 1994 ;  140 : 97-104 [cross-ref]

Cliquez ici pour aller à la section Références and 15Schulze-Osthoff K., Los M., Baeuerle P.A. Redox signaling by transcription factors NF-κB and AP-1 in lymphocytes Biochem Pharmacol 1995 ;  50 : 735-741 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. For these reasons, the study of mitochondrial oxidative stress in peripheral white blood cells from diabetic patients is an important piece of research that could open up new strategies for preventing late diabetic complications.

Oxidative stress results from an imbalance between ROS formation and antioxidant defences. Superoxide dismutases (SOD) are a family of metalloenzymes that convert the superoxide radical into hydrogen peroxide and molecular oxygen in an attempt to remove free radicals in mitochondria. The isoform found in mitochondria (manganese superoxide dismutase [MnSOD]) functions primarily to protect mitochondrial components from the superoxide liberated as a normal by-product of respiration. In the vast majority of SOD studies in diabetic patients, the activity of the extracellular <sup>[16Kimura F., Hasegawa G., Obayashi H., Adachi T., Hara H., Ohta M., et al. Serum extracellular superoxide dismutase in patients with type 2 diabetes: relationship to the development of micro- and macrovascular complications Diabetes Care 2003 ;  26 : 1246-1250 [cross-ref]

Cliquez ici pour aller à la section Références and 17Zitouni K., Nourooz-Zadeh J., Harry D., Kerry S.M., Betteridge D.J., Capuccio F.P., et al. Race-specific differences in antioxidant enzyme activity in patients with type 2 diabetes: a potential association with the risk of developing nephropathy Diabetes Care 2005 ;  28 : 1698-1703 [cross-ref]

Cliquez ici pour aller à la section Références]</sup> or cytosolic fraction (Cu/ZnSOD) <sup>[8Seghrouchni I., Drai J., Bannier E., Riviere J., Calmard P., Garcia I., et al. Oxidative stress parameters in type I, type II and insulin-treated type 2 diabetes mellitus; insulin treatment efficiency Clin Chim Acta 2002 ;  321 : 89-96 [cross-ref]

Cliquez ici pour aller à la section Références, 18Kesavulu M.M., Giri R., Kameswara Rao B., Apparao C. Lipid peroxidation and antioxidant enzyme levels in type 2 diabetics with microvascular complications Diabetes Metab 2000 ;  26 : 387-392 [inter-ref]

Cliquez ici pour aller à la section Références, 19Bhatia S., Shukla R., Venkata Madhu S., Kaur Gambhir J., Madhava Prabhu K. Antioxidant status, lipid peroxidation and nitric oxide end products in patients of type 2 diabetes mellitus with nephropathy Clin Biochem 2003 ;  36 : 557-562 [cross-ref]

Cliquez ici pour aller à la section Références and 20Vucic M., Gavella M., Bozikov V., Aschcroft S.J., Rocic B. Superoxide dismutase activity in lymphocytes and polymorphonuclear cells of diabetic patients Eur J Clin Chem Clin Biochem 1997 ;  35 : 517-521

Cliquez ici pour aller à la section Références]</sup>, but not of MnSOD, has been measured. However, it has been recently demonstrated that MnSOD plays a substantial role in protecting mouse retina from diabetes-induced oxidative stress.

There are plenty of studies demonstrating that plasma measures of oxidative stress are increased in both type 1 and type 2 diabetes, particularly in those with late diabetic complications <sup>[21Stephens J.W., Gable D.R., Hurel S.J., Miller G.J., Cooper J.A., Humphries S.E. Increased plasma markers of oxidative stress are associated with coronary heart disease in males with diabetes mellitus and with 10-year risk in a prospective sample of males Clin Chem 2006 ;  52 : 446-452 [cross-ref]

Cliquez ici pour aller à la section Références and 22Ziegler D., Sohr C.G., Nourooz-Zadeh J. Oxidative stress and antioxidant defense in relation to the severity of diabetic polyneuropathy and cardiovascular autonomic neuropathy Diabetes Care 2004 ;  27 : 2178-2183 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. However, the results in plasma have to be interpreted with caution, as they do not adequately mirror the situation in the tissues. In addition, a wide variability due to changes in dietary intake and physical activity has been reported <sup>[23Dragsted L.O., Pedersen A., Hermetter A., Basu S., Hansen M., Haren G.R., et al. The 6-a-day study: effects of fruit and vegetables on markers of oxidative stress and antioxidative defense in healthy nonsmokers Am J Clin Nutr 2004 ;  79 : 1060-1072

Cliquez ici pour aller à la section Références and 24Sen C. Oxidants and antioxidants in exercise J Appl Physiol 1995 ;  79 : 675-686

Cliquez ici pour aller à la section Références]</sup>. Mitochondria play a key role in the production of free radicals and antioxidant defences and, therefore, their direct study permits a more accurate assessment of the degree of oxidative stress. However, there are no studies in which the balance between the parameters of oxidative stress and antioxidant defences have been assessed in the mitochondria of peripheral blood cells from diabetic patients.

The aim of the present study was to investigate the relevance of oxidative stress in the mitochondria of peripheral blood mononuclear cells (PBMCs) in type 2 diabetic patients with late complications. For this reason, mtDNA oxidative damage and mtDNA content have been measured as indices of oxidative stress. MnSOD activity has been used as an index of mitochondrial antioxidant defence. Finally, the functional effect of mtDNA oxidative damage on the mitochondrial respiratory chain has also been investigated.

	Material and methods

	Subjects

Ten type 2 diabetic patients with late diabetic complications were prospectively recruited from the outpatients diabetic unit of a university hospital. These patients were selected because oxidative stress is significantly higher in type 2 diabetic patients who have both micro- and macrovascular complications. To avoid other oxidative stress conditions unrelated to diabetes, we excluded patients who were smokers, and those with renal failure (creatinine ≥120μmol/L), acute infections and chronic diseases apart from diabetes. Type 2 diabetes was diagnosed according the american diabetes association (ADA) definition <sup>[25American Diabetes Association Diagnosis and classification of diabetes mellitus Diabetes Care 2006 ;  29 : S43-S48

Cliquez ici pour aller à la section Références]</sup>. As controls, 10 non-smoking age-matched healthy volunteers were randomly selected. The clinical features of these diabetic patients and control subjects are presented in Table 1. None of the diabetic patients or healthy controls had received antioxidant supplementation or any treatment (apart from insulin and oral hypoglycaemic agents) that could significantly influence oxidative stress.

Fasting venous blood samples were obtained from each study participant and immediately processed to obtain peripheral blood mononuclear cells. PBMCs were isolated by density-gradient centrifugation using Vacutainer CPT tubes (BD Vacutainer™ CPT™ Tube, BD Diagnostics, Franklin Lakes, NJ, USA). In brief, blood samples were remixed prior to centrifugation by gently inverting the tubes eight to 10 times. The tubes were then centrifuged at 19°C for 30min at 1700g. Immediately afterwards, the cell layer containing mononuclear cells and platelets was collected using a Pasteur pipette, and transferred to a 15-mL centrifuge tube and capped. The pellets were then suspended in phosphate buffered saline (PBS) and washed in three steps to remove platelets, as recommended by the manufacturer.

The study was conducted according to the guidelines laid down in the Helsinki Declaration and approved by a local ethics committee. All participants gave their informed consent.

	Measurement of mtDNA content

Total DNA was extracted from PBMCs using a QIAamp DNA Mini Kit (QIAGEN GmbH, Germany) and quantitated spectrophotometrically. MtDNA content was measured using the real-time (RT) PCR method with the 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA). mtDNA quantity was corrected by simultaneous measurement of a single copy nuclear RNAse P gene. Briefly, the primers for RT-QPCR analysis of mtDNA were mt806F (5′CCACGGGAAACAGCAGTGATT3′) and mt929R 5′CTATTGACTTGGGTTAATCGTGTGA3′). The TaqMan probe, 6FAM-5′TGCCAGCCACCGCG3′-MGB, was labeled at the 5′ end with the fluorescent reporter 6FAM. To quantify nDNA, a commercial kit was used (PDARs RNAseP; Applied Biosystems), and the nDNA-specific fluorescent probe labeled internally using the fluorescent dye VIC. The 20μL PCR reaction contained 1×TaqMan Universal PCR Master Mix (ABI P/N 4304437), 1uL of PDARs RNAseP and 112nM of each mtDNA primer, 125nM of mtDNA TaqMan probe and 0.2–2ng of total genomic DNA extract. PCR conditions were 2min at 50°C and 10min at 95°C, followed by 40 cycles of 15s of denaturation at 95°C and 60s of annealing/extension at 60°C. The copy number of mtDNA and nDNA was calculated from Ct number and by use of a standard curve. The data are expressed as the means of three measurements.

	Measurement of mtDNA oxidation (QPCR)

Total DNA was extracted using QIAamp DNA Mini Kit (QIAGEN GmbH, Germany) and quantitated spectrophotometrically. Aliquots of DNA (50–100ng) were then subjected to QPCR. Two fragments of mtDNA were amplified: mtDNA primers for the 8.9-kb fragment: mt5999F (5′-TCTAAGCCTCCTTATTCGAGCCGA-3′) and mt14841R (5′-TTTCATCATGCGGAGATGTTGGATGG-3′); for the 207-bp fragment: mt4181F (5′-ACTTCCTACCACTCACCCTA-3′) and mt4388R (5′-TGATAGGTGGCACGGACAAT-3′). QPCRs were performed with the GeneAmp XL PCR kit (Perkin–Elmer) as previously described <sup>[26Gonzalo R., García-Arumí E., Lligé D., Martí R., Solano A., Montoya J., et al. Free radicals-mediated damage in transmitochondrial cells harboring the T14487C mutation in the ND6 gene of mtDNA FEBS Lett 2005 ;  579 : 6909-6913 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. An aliquot of each PCR product was resolved on a 0.8% agarose gel and electrophoresed in TBE at 90V for 45min. The gels were stained with EtBr, and the density of the bands determined and processed using Quantity One^® software (Biorad, Hercules, CA).

The assay was based on the premise that DNA lesions (including oxidative damage such as strand breaks, base modifications and abasic sites) block the progression of polymerase, resulting in decreased DNA amplification in the damaged template <sup>[27Santos J.H., Mandavilli B.S., Van Houten B. Measuring oxidative mtDNA damage and repair using quantitative PCR Methods Mol Biol 2002 ;  197 : 159-176 [cross-ref]

Cliquez ici pour aller à la section Références and 28Kalinowski D., Illenye S., Van Houten B. Analysis of DNA damage and repair in murine leukemia L1210 cells using a quantitative polymerase chain reaction assay Nucleic Acid Res 1992 ;  20 : 3485-3494

Cliquez ici pour aller à la section Références]</sup>. Thus, amplification is inversely proportional to DNA damage: the more lesions encountered on the target DNA, the less the amplification. Note that, for the mitochondrial genome, both a short (221bp) and a long (8.9kb) fragment were routinely amplified. The rationale for this is that the probability of introducing a lesion in a short segment is low and, therefore, amplification of this segment gives an accurate estimation of the copy number of mtDNA in the sample. The data obtained from the small fragment were subsequently used to normalise the results of the 8.9-kb target <sup>[26Gonzalo R., García-Arumí E., Lligé D., Martí R., Solano A., Montoya J., et al. Free radicals-mediated damage in transmitochondrial cells harboring the T14487C mutation in the ND6 gene of mtDNA FEBS Lett 2005 ;  579 : 6909-6913 [cross-ref]

Cliquez ici pour aller à la section Références and 27Santos J.H., Mandavilli B.S., Van Houten B. Measuring oxidative mtDNA damage and repair using quantitative PCR Methods Mol Biol 2002 ;  197 : 159-176 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. The relative amplification was calculated, and the mean value obtained in the controls was considered the normal value (100% of relative amplification). Thus, the lower the value, the higher the degree of mtDNA oxidation.

	MnSOD enzyme activity

PBMCs were homogenised by sonication and centrifuged for 10min (12,000×g, 4°C) to isolate the supernatants. MnSOD was measured via inhibition of the reduction of cytochrome C by O₂ ^–, produced by oxidation of xanthine by xanthine oxidase in the presence of KCN <sup>[29McCord J.M., Fridovich I. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein) J Biol Chem 1969 ;  244 : 6049-6055

Cliquez ici pour aller à la section Références]</sup>.

	Respiratory-chain enzyme

Cytochrome C oxidase (COX) activity was measured using reduced cytochrome C as the substrate. Cytochrome C oxidation was monitored at 550nm <sup>[30Rustin P., Chretien D., Bourgeron T., Gerard B., Rötig A., Saudubray J.M., et al. Biochemical and molecular investigations in respiratory chain deficiencies Clin Chim Acta 1994 ;  228 : 35-51 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>.

Citrate synthase (CS) activity was used as a marker of mitochondrial content. This enzyme catalyses the acetyl-coenzyme A oxalacetate reaction resulting in citrate and coenzyme A. This latter product was measured using 55′-dithiobis-(2-nitrobenzoic acid) (DTNB). The reaction was monitored at 412nm <sup>[31Srere P.A. Citrate synthase Methods Enzymol 1969 ;  13 : 3-11 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>.

Enzyme activity was expressed per milligram of protein. Protein content was determined using the Coomassie Plus protein assay reagent (Pierce, Rockford, IL). In addition, we calculated the ratio of COX/CS activity to express COX activity by mitochondrial content.

	Statistical analysis

Data were expressed as means±S.D. Differences in measured parameters between the control and patient groups were assessed by Studentʼs t test. Correlation analysis was performed using Spearmanʼs correlation coefficient. Statistical significance was defined as P <0.05.

	Results

	mtDNA oxidation

The relative mtDNA amplification in PBMCs was significantly lower in type 2 diabetic patients than in the control group (67.1±13.2% versus 100.4±9.4%; P <0.0001) (Fig. 1). This result indicates that mtDNA oxidation was significantly higher in diabetic patients than in the control subjects.

Fig. 1
	Fig. 1. (A): mitochondrial DNA (mtDNA) oxidative damage. The upper panel shows the amplification efficiency in diabetic subjects compared with healthy controls. The lower panel is a representative of the QPCR amplification product of the 8.9kb and 207pb fragments. Control subjects: C1, C2; diabetic patients: D1, D2; M: molecular weight marker. (B): mitochondrial DNA content in PBMCs from type 2 diabetic patients and control subjects. Data are means±S.D. Zoom

	mtDNA content

The mtDNA content was also lower in the diabetic group, but was not statistically significant (117.1±36.1 versus 153.2±52.8 mtDNA/nuclear DNA copies; P =0.09) (Fig. 1). A direct correlation between mtDNA relative amplification and mtDNA content was observed (r =0.43; P =0.05) (Fig. 2). The difference in mtDNA content between diabetic patients and healthy controls could not be attributed to the presence of the 4977-bp common deletion as this had been ruled out in all participants.

Fig. 2
	Fig. 2. (A): correlation between mtDNA content and the relative mtDNA amplification in PBMCs. (B): correlation between MnSOD enzyme activity and the relative mtDNA amplification in PBMCs. Open circles: healthy controls; filled circles: type 2 diabetic patients. Zoom

	MnSOD

MnSOD enzyme activity was significantly increased in PBMCs of type 2 diabetic patients compared with healthy controls (1366±187 versus 686±167U/g protein; P =0.01). An inverse correlation between MnSOD activity and relative mtDNA amplification was detected on analysis of the diabetic patients and controls (r =−0.57; P =0.02) (Fig. 2). However, when the patients and healthy controls were analysed separately, this relationship was lost.

	Respiratory-chain enzyme

No differences in mitochondrial respiratory-chain function (COX activity per milligram of protein or by mitochondrial content) between diabetic patients and controls were found (Table 2).

	Discussion

In the present study, we found a higher degree of mtDNA oxidative damage as well as an increase in antioxidant status in PBMCs from type 2 diabetic patients with diabetic complications in comparison to healthy subjects. The correlation between mtDNA content and mtDNA relative amplification suggests that oxidative stress is a main contributor to the depletion of mtDNA observed in diabetic patients. The increase in MnSOD activity detected in diabetic PBMCs was inversely related to the relative mtDNA amplification, thus supporting the concept that MnSOD is upregulated by oxidative stress. In addition, these findings provide evidence that a reduction of MnSOD activity is not primarily involved in the oxidative damage detected in type 2 diabetic patients. However, the increase of MnSOD activity was not enough to counterbalance the degree of oxidative stress and so avoid mtDNA depletion. It must be emphasised that these findings have been detected in PBMCs, which have a rapid turnover, thus preventing accumulation of mtDNA abnormalities. Therefore, it may be that mtDNA oxidative damage could be even more exaggerated in tissues as a consequence of long-term oxidative stress such as seen with late diabetic complications.

Previous reports have shown a higher accumulation of the A3243G point mutation and somatic transversion point mutations of mtDNA in PBMCs of type 2 diabetic patients compared with healthy subjects <sup>[32Nomiyama T., Tanaka Y., Hattori N., Nishimaki K., Nagasaka K., Kawamori R., et al. Accumulation of somatic mutation in mitochondrial DNA extracted from peripheral blood cells in diabetic patients Diabetologia 2002 ;  45 : 1577-1583

Cliquez ici pour aller à la section Références and 33Kamiya J., Aoki Y. Associations between hyperglycaemia and somatic transversion mutations in mitochondrial DNA of people with diabetes mellitus Diabetologia 2003 ;  46 : 1559-1566 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. Furthermore, significant decreases in mtDNA content in PBMCs from both type 1 and type 2 diabetic patients, and also in the peripheral blood of the offspring of type 2 diabetic patients, have been demonstrated <sup>[34Song J., Young J., Sung Y.A., Park Y.K., Park K.S., Lee H.K. Peripheral blood mitochondrial DNA content is related to insulin sensitivity in offspring of type 2 diabetic patients Diabetes Care 2001 ;  24 : 865-869 [cross-ref]

Cliquez ici pour aller à la section Références and 35Lee H.K., Song J.H., Shin C.S., Park D.J., Park K.S., Lee K.U., et al. Decreased mitochondrial DNA content in peripheral blood precedes the development of non-insulin-dependent diabetes mellitus Diabetes Res Clin Pract 1998 ;  42 : 161-167 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. Unfortunately, measurements of oxidative stress were not reported in those studies.

Oxidative DNA damage has been found to be increased in leukocytes from type 1 and type 2 diabetic patients in comparison to healthy controls <sup>[36Dincer Y., Akcay T., Ilkova H., Alademir Z., Ozbay G. DNA damage and antioxidant defense in peripheral leukocytes of patients with type I diabetes mellitus Mutat Res 2003 ;  527 : 49-55 [cross-ref]

Cliquez ici pour aller à la section Références and 37Pitozzi V., Giovannelli L., Bardini G., Rotella C.M., Dolara P. Oxidative DNA damage in peripheral blood cells in type 2 diabetes mellitus: higher vulnerability of polymorphonuclear leukocytes Mutat Res 2003 ;  529 : 129-133 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. However, in those studies, mtDNA and MnSOD were not analysed. In the present study, mtDNA oxidation was determined by an indirect method based on the premise that DNA lesions result in decreased DNA amplification. Therefore, apart from oxidative damage, other DNA lesions might eventually affect the results. Advanced glycation end-products (AGEs) have been involved in DNA damage <sup>[38Stitt A.W., Jenkins A.J., Cooper M.E. Advanced glycation end products and diabetic complications Expert Opin Investig Drugs 2002 ;  11 : 1205-1223 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. However, a significant contribution of AGEs to mtDNA impairment in cells with rapid turnovers such as PBMCs seems unlikely. In addition, in the present study, the 4977-bp common deletion was ruled out. Furthermore, patients with other oxidative stress conditions such as renal failure or a smoking habit were excluded from the study. Therefore, it may be assumed that mtDNA oxidation secondary to the diabetic milieu is the main factor accounting for the reduced mtDNA amplification in PBMCs detected in diabetic patients.

Two previous reports have investigated the mitochondrial fraction of SOD in the peripheral blood cells of diabetic patients, and both found a significant decrease in MnSOD activity in diabetics <sup>[39Nath N., Chari S.N., Rathi A.B. Superoxide dismutase in diabetic polymorphonuclear leukocytes Diabetes 1984 ;  33 : 586-589

Cliquez ici pour aller à la section Références and 40Uchimura K., Nagasaka A., Hayashi R., Makino M., Nagata M., Kakizawa H., et al. Changes in superoxide dismutase activities and concentrations and myeloperoxidase activities in leukocytes from patients with diabetes mellitus J Diab Compl 1999 ;  13 : 264-270 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. However, in our study, a significant increase in MnSOD activity was found in the PBMCs of the diabetic patients. However, both methodological and clinical differences among these studies may explain the conflicting results. Although similar methods were used to determine enzyme activity in these studies, there were discrepancies in terms of sample collection and blood-cell separation. More important, the diabetic patients were different in terms of age, duration of diabetes and presence of vascular complications. It is worth noting that, in the cohort reported by Uchimura et al. <sup>[40Uchimura K., Nagasaka A., Hayashi R., Makino M., Nagata M., Kakizawa H., et al. Changes in superoxide dismutase activities and concentrations and myeloperoxidase activities in leukocytes from patients with diabetes mellitus J Diab Compl 1999 ;  13 : 264-270 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>, patients were 15 years younger than those included in our study. In addition, the diabetic patients included in the present study suffered from several micro- and macrovascular complications, reflecting a higher degree of oxidative damage. As MnSOD is an inducible enzyme upregulated by oxidative stress <sup>[41MacMillan-Crow L.A., Cruthirds D.L. Manganese superoxide dismutase in disease Free Radic Res 2001 ;  34 : 325-336 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>, it is to be expected that the higher the oxidative stress, the higher the degree of MnSOD activity. In fact, MnSOD activity is used as an indirect measurement of oxidative stress <sup>[41MacMillan-Crow L.A., Cruthirds D.L. Manganese superoxide dismutase in disease Free Radic Res 2001 ;  34 : 325-336 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. However, measurements of oxidative stress were not provided in the two studies previously mentioned <sup>[39Nath N., Chari S.N., Rathi A.B. Superoxide dismutase in diabetic polymorphonuclear leukocytes Diabetes 1984 ;  33 : 586-589

Cliquez ici pour aller à la section Références and 40Uchimura K., Nagasaka A., Hayashi R., Makino M., Nagata M., Kakizawa H., et al. Changes in superoxide dismutase activities and concentrations and myeloperoxidase activities in leukocytes from patients with diabetes mellitus J Diab Compl 1999 ;  13 : 264-270 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. We have recently demonstrated that cybrids harbouring mutations in mtDNA show an increased rate of ROS production, with a parallel increase in the activity of several antioxidant enzymes, which can protect cells from oxidative damage <sup>[42Vives-Bauza C., Gonzalo R., Manfredi G., García-Arumí E., Andreu A.L. Enhanced ROS production and antioxidant defenses in cybrids harbouring mutations in mtDNA Neurosci Lett 2006 ;  391 : 136-141 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. Thus, the elevated MnSOD activity found in our diabetic group may point to an adaptive reaction to oxidative stress due to free radical overproduction and increased enzyme biosynthesis.

It has also been suggested that mitochondria are important in the activation of NFκB, a protein that plays a central role in the regulation of many of the genes involved in cellular defence mechanisms, pathogen defences, immunological responses, and the expression of cytokines and cell-adhesion molecules. The ROS generated in the mitochondrial respiratory chain have been proposed as being the intermediate messengers involved in the activation of NFκB by TNF and IL-1 <sup>[13Devary Y., Rosette C., DiDonato J.A., Karin M. NF-kappa B activation by ultraviolet light not dependent on a nuclear signal Science 1993 ;  261 : 1442-1445

Cliquez ici pour aller à la section Références, 14Mohan N., Meltz M.M. Induction of nuclear factor kB after low-dose ionizing radiation involves a reactive oxygen intermediate signaling pathway Radiat Res 1994 ;  140 : 97-104 [cross-ref]

Cliquez ici pour aller à la section Références and 15Schulze-Osthoff K., Los M., Baeuerle P.A. Redox signaling by transcription factors NF-κB and AP-1 in lymphocytes Biochem Pharmacol 1995 ;  50 : 735-741 [cross-ref]

Cliquez ici pour aller à la section Références]</sup>. It is possible that the relative balance between the stimuli of mitochondrial oxidant production and the concomitant accumulation of organellar damage can ultimately influence cellular response and function. Consequently, mitochondrial damage may serve as a general, yet direct, indicator or predictor of mitochondrial dysfunction. Thus, the mtDNA oxidative damage detected in the present study could contribute to the immune deficits described in diabetic patients as well as to the development of diabetic complications. Reestablishment of the balance between oxidative stress and antioxidant defences in the mitochondria may well be crucial for normalisation of mitochondrial function as well as preventing diabetes complications. Nishikawa et al. <sup>[4Nishikawa T., Edelstein D., Du X.L., Yamagishi S., Matsumura T., Kaneda Y., et al. Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage Nature 2000 ;  404 : 787-790

Cliquez ici pour aller à la section Références]</sup> have shown that normalising mitochondrial ROS levels by overexpressing MnSOD in endothelial cells prevents high glucose-induced activation of at least three different pathological pathways related to late diabetic complications. Shen et al. <sup>[43Shen X., Zheng S., Metrevell N.S., Epstein P.N. Protection of cardiac mitochondria by overexpression of MnSOD reduces diabetic cardiomyopathy Diabetes 2006 ;  55 : 798-805 [cross-ref]

Cliquez ici pour aller à la section Références]</sup> recently demonstrated that overexpression of MnSOD in the hearts of transgenic mice completely reversed diabetes-damaged cardiac morphology and impaired contractility. In addition, Kowluru et al. <sup>[44Kowluru R.A., Kowluru V., Xiong Y., Ho Y.S. Overexpression of mitochondrial superoxide dismutase in mice protects the retina from diabetes-induced oxidative stress Free Radic Biol Med 2006 ;  41 : 1191-1196 [cross-ref]

Cliquez ici pour aller à la section Références]</sup> showed that overexpression of MnSOD in mice protects the retina from diabetes-induced oxidative stress.

Finally, the increased degree of mtDNA oxidation with the decreased amount of mtDNA observed in diabetic subjects in comparison to the healthy controls was not associated with a decrease in COX activity (complex IV of the mitochondrial respiratory chain). It should be noted that mtDNA damage of more than 80% is necessary to induce mitochondrial respiratory-chain dysfunction <sup>[45Boulet L., Karpati G., Shoubridge E.A. Distribution and threshold expression of the tRNA(Lys) mutation in skeletal muscle of patients with myoclonic epilepsy and ragged-red fibers (MERRF) Am J Hum Genet 1992 ;  51 : 1187-1200

Cliquez ici pour aller à la section Références and 46Sciacco M., Bonilla E., Schon E.A., DiMauro S., Moraes C.T. Distribution of wild-type and common deletion forms of mtDNA in normal and respiration-deficient muscle fibers from patients with mitochondrial myopathy Hum Mol Genet 1994 ;  3 : 13-19

Cliquez ici pour aller à la section Références]</sup>. In the present study, the reduction of mtDNA content in diabetic patients was only 23%; therefore, as expected, there was no effect on COX activity.

In summary, in the present study, we demonstrated an increased amount of mtDNA oxidative damage in PMBCs from type 2 diabetic patients with late diabetic complications in comparison to healthy subjects. The degree of mtDNA oxidation was associated with a reduction of mtDNA content as well as an increase of MnSOD as an adaptive response against oxidative stress. Whether these mitochondrial alterations on PMBCs could have an effect on their functioning, thereby explaining the increased susceptibility of diabetic patients to certain infections, and/or contribute to the development of late diabetic complications remains to be elucidated.

This study was supported by grants from Lilly S.A. and the Ministerio de Sanidad y Consumo, Instituto de Salud Carlos III (CIBERDEM). We thank David Lligé for his technical assistance.