Publicité


Article gratuit !

Diabetes & Metabolism
Volume 34, numéro 2
pages 117-124 (avril 2008)
Doi : 10.1016/j.diabet.2007.10.011
Reçu le : 2 juillet 2007 ;  accepté le : 26 octobre 2007
Mitochondrial DNA oxidation and manganese superoxide dismutase activity in peripheral blood mononuclear cells from type 2 diabetic patients
Étude de l’oxydation de l’ADN mitochondrial et de l’activité de la manganèse superoxyde dismutase dans les cellules mononucléés du sang périphérique des patients diabétiques de type 2
 

M. García-Ramírez a, G. Francisco a, E. García-Arumí b, C. Hernández a, R. Martínez b, A.L. Andreu b, R. Simó a,
a CIBERDEM (ISCIII) and Diabetes Research Unit, Institut de Recerca, Hospital Universitari Vall d’Hebron, Universitat Autònoma de Barcelona (UAB), Barcelona, Spain 
b Centre d’investigacions en Bioquímica i Biologia Molecular, Institut de Recerca, Hospital Universitari Vall d’Hebron, Universitat Autònoma de Barcelona (UAB), Barcelona, Spain 

 Corresponding author.
Abstract
Aim

To investigate the balance between parameters of oxidative stress and antioxidant defences in the mitochondria of peripheral blood mononuclear cells (PBMCs) of type 2 diabetic patients with late complications.

Methods

Ten type 2 diabetic patients with late diabetic complications and 10 age-matched healthy volunteers (controls) were prospectively recruited. Mitochondrial DNA (mtDNA) oxidative damage and mtDNA content were measured as indices of oxidative stress. Manganese superoxide dismutase (MnSOD) activity has been used as an index of mitochondrial antioxidant defence. Mitochondrial respiratory-chain function (cytochrome C oxidase activity) was also assessed.

Results

Mitochondrial DNA (mtDNA) oxidation was significantly higher in the PBMCs of diabetic patients than in control subjects (P <0.0001) and, although mtDNA content was lower in the diabetic group, this was not statistically significant. MnSOD activity was significantly increased in PBMCs of type 2 diabetic patients compared with healthy controls (1366±187 versus 686±167U/g of protein; P =0.01), and was related to mtDNA oxidative damage. No differences in mitochondrial respiratory-chain function were found between diabetic patients and controls.

Conclusion

PMBCs from type 2 diabetic patients with late diabetic complications exhibit high mtDNA oxidative damage. The degree of mtDNA oxidation was associated with an increase in MnSOD as an adaptive response to oxidative stress. The consequences of mtDNA oxidative damage on PBMC function and the progression of diabetic complications remain to be elucidated.

Résumé
Objectif

Analyser l’équilibre entre les paramètres du stress oxydatif et les défenses antioxydantes dans la mitochondrie de cellules mononuclées du sang périphérique de diabétiques de type 2 atteints de complications.

Méthodes

Dix diabétiques du type 2 atteints de complications et dix témoins non diabétiques appariés selon le sexe et l’âge on été recrutés de manière prospective. Les altérations oxydatives de l’ADN mitochondrial (ADNmt) et le contenu en ADNmt ont été utilisés comme indices du stress oxydatif. L’activité de la manganèse superoxyde dismutase (MnSOD) a été utilisée comme indice des défenses antioxydantes mitochondriales. La fonction de la chaîne respiratoire mitochondriale (activité de la cytochrome C oxydase) a été également analysée.

Résultats

Les cellules mononuclées des diabétiques de type 2 présentaient des signes d’agression radicalaire plus importants que celles des témoins (P <0,001). Le contenu en ADNmt n’était pas significativement modifié chez les diabétiques. L’activité de la MnSOD était augmentée dans les cellules mononuclées des diabétiques, comparées aux témoins (1366±187 versus 686±167U/g protéine, P =0,01), en corrélation avec les altérations de l’ADNmt liées à l’oxydation. La fonction de la chaîne respiratoire mitochondriale était comparable dans les deux groupes.

Conclusion

Les cellules mononuclées périphériques des diabétiques de type 2 atteints de complications présentaient des altérations liées à l’oxydation de l’ADNmt plus importantes. Le degré d’oxydation de l’ADNmt était associé à une augmentation de l’activité de la MnSOD comme réponse adaptative au stress oxydant. Les conséquences des altérations de l’ADNmt liées au stress oxydant sur la fonction des cellules mononuclées périphériques et la progression de complications restent à déterminer.


Keywords : Type 2 diabetes, Mitochondria, Mitochondrial DNA, Oxidative stress, Manganese superoxide dismutase, Diabetic complications

Mots clés : Diabète de type 2, Mitochondries, ADN mitochondrial, Stress oxydatif, Manganèse superoxyde dismutase, Complications


Introduction

Increasing evidence in both experimental and clinical studies suggests that there is a close link between oxidative stress, impaired mitochondrial function, and the pathogenesis of diabetes mellitus and its vascular complications [1 and 2]. Hyperglycaemia induces an overproduction of reactive oxygen species (ROS) and also attenuates antioxidative mechanisms contributing to a pro-oxidant state [3, 4, 5 and 6]. ROS generated by mitochondria in response to hyperglycaemia induce protein, lipid and DNA modifications [7, 8 and 9]. Mitochondrial DNA (mtDNA) is markedly vulnerable to oxidative stress, resulting in both qualitative and quantitative changes [10]. These changes can impair cell function and participate in the apoptosis mediated by hyperglycaemia that occurs in the target tissues found in late diabetic complications [11 and 12].

Apart from these target tissues (including the retina, kidney and peripheral nerves) in which late diabetic complications develop, peripheral white blood cells are also damaged by oxidative stress. These cells are more easily obtained, but have disadvantages such as having fewer mitochondria and an invariably low degree of heteroplasmy due to their rapid turnover. Nevertheless, the study of mitochondrial oxidative stress in peripheral white blood cells is of interest as a reflection of events taking place in the tissues targeted by diabetic complications. Moreover, the study of mitochondrial oxidative stress in the peripheral white blood cells is itself of interest. This is because diabetes is associated with an increased risk of infection and, therefore, it is possible that mitochondrial dysfunction in peripheral white blood cells could contribute to the abnormalities in adherence, chemotaxis, phagocytosis and intracellular killing reported in diabetic patients. Furthermore, the impaired mitochondrial machinery in peripheral blood cells could result in a more pro-inflammatory cytokine profile that contributes to the pathogenesis of diabetic complications [13, 14 and 15]. For these reasons, the study of mitochondrial oxidative stress in peripheral white blood cells from diabetic patients is an important piece of research that could open up new strategies for preventing late diabetic complications.

Oxidative stress results from an imbalance between ROS formation and antioxidant defences. Superoxide dismutases (SOD) are a family of metalloenzymes that convert the superoxide radical into hydrogen peroxide and molecular oxygen in an attempt to remove free radicals in mitochondria. The isoform found in mitochondria (manganese superoxide dismutase [MnSOD]) functions primarily to protect mitochondrial components from the superoxide liberated as a normal by-product of respiration. In the vast majority of SOD studies in diabetic patients, the activity of the extracellular [16 and 17] or cytosolic fraction (Cu/ZnSOD) [8, 18, 19 and 20], but not of MnSOD, has been measured. However, it has been recently demonstrated that MnSOD plays a substantial role in protecting mouse retina from diabetes-induced oxidative stress.

There are plenty of studies demonstrating that plasma measures of oxidative stress are increased in both type 1 and type 2 diabetes, particularly in those with late diabetic complications [21 and 22]. However, the results in plasma have to be interpreted with caution, as they do not adequately mirror the situation in the tissues. In addition, a wide variability due to changes in dietary intake and physical activity has been reported [23 and 24]. Mitochondria play a key role in the production of free radicals and antioxidant defences and, therefore, their direct study permits a more accurate assessment of the degree of oxidative stress. However, there are no studies in which the balance between the parameters of oxidative stress and antioxidant defences have been assessed in the mitochondria of peripheral blood cells from diabetic patients.

The aim of the present study was to investigate the relevance of oxidative stress in the mitochondria of peripheral blood mononuclear cells (PBMCs) in type 2 diabetic patients with late complications. For this reason, mtDNA oxidative damage and mtDNA content have been measured as indices of oxidative stress. MnSOD activity has been used as an index of mitochondrial antioxidant defence. Finally, the functional effect of mtDNA oxidative damage on the mitochondrial respiratory chain has also been investigated.

Material and methods
Subjects

Ten type 2 diabetic patients with late diabetic complications were prospectively recruited from the outpatients diabetic unit of a university hospital. These patients were selected because oxidative stress is significantly higher in type 2 diabetic patients who have both micro- and macrovascular complications. To avoid other oxidative stress conditions unrelated to diabetes, we excluded patients who were smokers, and those with renal failure (creatinine ≥120μmol/L), acute infections and chronic diseases apart from diabetes. Type 2 diabetes was diagnosed according the american diabetes association (ADA) definition [25]. As controls, 10 non-smoking age-matched healthy volunteers were randomly selected. The clinical features of these diabetic patients and control subjects are presented in Table 1. None of the diabetic patients or healthy controls had received antioxidant supplementation or any treatment (apart from insulin and oral hypoglycaemic agents) that could significantly influence oxidative stress.

Fasting venous blood samples were obtained from each study participant and immediately processed to obtain peripheral blood mononuclear cells. PBMCs were isolated by density-gradient centrifugation using Vacutainer CPT tubes (BD Vacutainer™ CPT™ Tube, BD Diagnostics, Franklin Lakes, NJ, USA). In brief, blood samples were remixed prior to centrifugation by gently inverting the tubes eight to 10 times. The tubes were then centrifuged at 19°C for 30min at 1700g. Immediately afterwards, the cell layer containing mononuclear cells and platelets was collected using a Pasteur pipette, and transferred to a 15-mL centrifuge tube and capped. The pellets were then suspended in phosphate buffered saline (PBS) and washed in three steps to remove platelets, as recommended by the manufacturer.

The study was conducted according to the guidelines laid down in the Helsinki Declaration and approved by a local ethics committee. All participants gave their informed consent.

Measurement of mtDNA content

Total DNA was extracted from PBMCs using a QIAamp DNA Mini Kit (QIAGEN GmbH, Germany) and quantitated spectrophotometrically. MtDNA content was measured using the real-time (RT) PCR method with the 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA). mtDNA quantity was corrected by simultaneous measurement of a single copy nuclear RNAse P gene. Briefly, the primers for RT-QPCR analysis of mtDNA were mt806F (5′CCACGGGAAACAGCAGTGATT3′) and mt929R 5′CTATTGACTTGGGTTAATCGTGTGA3′). The TaqMan probe, 6FAM-5′TGCCAGCCACCGCG3′-MGB, was labeled at the 5′ end with the fluorescent reporter 6FAM. To quantify nDNA, a commercial kit was used (PDARs RNAseP; Applied Biosystems), and the nDNA-specific fluorescent probe labeled internally using the fluorescent dye VIC. The 20μL PCR reaction contained 1×TaqMan Universal PCR Master Mix (ABI P/N 4304437), 1uL of PDARs RNAseP and 112nM of each mtDNA primer, 125nM of mtDNA TaqMan probe and 0.2–2ng of total genomic DNA extract. PCR conditions were 2min at 50°C and 10min at 95°C, followed by 40 cycles of 15s of denaturation at 95°C and 60s of annealing/extension at 60°C. The copy number of mtDNA and nDNA was calculated from Ct number and by use of a standard curve. The data are expressed as the means of three measurements.

Measurement of mtDNA oxidation (QPCR)

Total DNA was extracted using QIAamp DNA Mini Kit (QIAGEN GmbH, Germany) and quantitated spectrophotometrically. Aliquots of DNA (50–100ng) were then subjected to QPCR. Two fragments of mtDNA were amplified: mtDNA primers for the 8.9-kb fragment: mt5999F (5′-TCTAAGCCTCCTTATTCGAGCCGA-3′) and mt14841R (5′-TTTCATCATGCGGAGATGTTGGATGG-3′); for the 207-bp fragment: mt4181F (5′-ACTTCCTACCACTCACCCTA-3′) and mt4388R (5′-TGATAGGTGGCACGGACAAT-3′). QPCRs were performed with the GeneAmp XL PCR kit (Perkin–Elmer) as previously described [26]. An aliquot of each PCR product was resolved on a 0.8% agarose gel and electrophoresed in TBE at 90V for 45min. The gels were stained with EtBr, and the density of the bands determined and processed using Quantity One® software (Biorad, Hercules, CA).

The assay was based on the premise that DNA lesions (including oxidative damage such as strand breaks, base modifications and abasic sites) block the progression of polymerase, resulting in decreased DNA amplification in the damaged template [27 and 28]. Thus, amplification is inversely proportional to DNA damage: the more lesions encountered on the target DNA, the less the amplification. Note that, for the mitochondrial genome, both a short (221bp) and a long (8.9kb) fragment were routinely amplified. The rationale for this is that the probability of introducing a lesion in a short segment is low and, therefore, amplification of this segment gives an accurate estimation of the copy number of mtDNA in the sample. The data obtained from the small fragment were subsequently used to normalise the results of the 8.9-kb target [26 and 27]. The relative amplification was calculated, and the mean value obtained in the controls was considered the normal value (100% of relative amplification). Thus, the lower the value, the higher the degree of mtDNA oxidation.

MnSOD enzyme activity

PBMCs were homogenised by sonication and centrifuged for 10min (12,000×g, 4°C) to isolate the supernatants. MnSOD was measured via inhibition of the reduction of cytochrome C by O2 , produced by oxidation of xanthine by xanthine oxidase in the presence of KCN [29].

Respiratory-chain enzyme

Cytochrome C oxidase (COX) activity was measured using reduced cytochrome C as the substrate. Cytochrome C oxidation was monitored at 550nm [30].

Citrate synthase (CS) activity was used as a marker of mitochondrial content. This enzyme catalyses the acetyl-coenzyme A oxalacetate reaction resulting in citrate and coenzyme A. This latter product was measured using 55′-dithiobis-(2-nitrobenzoic acid) (DTNB). The reaction was monitored at 412nm [31].

Enzyme activity was expressed per milligram of protein. Protein content was determined using the Coomassie Plus protein assay reagent (Pierce, Rockford, IL). In addition, we calculated the ratio of COX/CS activity to express COX activity by mitochondrial content.

Statistical analysis

Data were expressed as means±S.D. Differences in measured parameters between the control and patient groups were assessed by Studentʼs t test. Correlation analysis was performed using Spearmanʼs correlation coefficient. Statistical significance was defined as P <0.05.

Results
mtDNA oxidation

The relative mtDNA amplification in PBMCs was significantly lower in type 2 diabetic patients than in the control group (67.1±13.2% versus 100.4±9.4%; P <0.0001) (Fig. 1). This result indicates that mtDNA oxidation was significantly higher in diabetic patients than in the control subjects.



Fig. 1


Fig. 1. 

(A): mitochondrial DNA (mtDNA) oxidative damage. The upper panel shows the amplification efficiency in diabetic subjects compared with healthy controls. The lower panel is a representative of the QPCR amplification product of the 8.9kb and 207pb fragments. Control subjects: C1, C2; diabetic patients: D1, D2; M: molecular weight marker. (B): mitochondrial DNA content in PBMCs from type 2 diabetic patients and control subjects. Data are means±S.D.

Zoom

mtDNA content

The mtDNA content was also lower in the diabetic group, but was not statistically significant (117.1±36.1 versus 153.2±52.8 mtDNA/nuclear DNA copies; P =0.09) (Fig. 1). A direct correlation between mtDNA relative amplification and mtDNA content was observed (r =0.43; P =0.05) (Fig. 2). The difference in mtDNA content between diabetic patients and healthy controls could not be attributed to the presence of the 4977-bp common deletion as this had been ruled out in all participants.



Fig. 2


Fig. 2. 

(A): correlation between mtDNA content and the relative mtDNA amplification in PBMCs. (B): correlation between MnSOD enzyme activity and the relative mtDNA amplification in PBMCs. Open circles: healthy controls; filled circles: type 2 diabetic patients.

Zoom

MnSOD

MnSOD enzyme activity was significantly increased in PBMCs of type 2 diabetic patients compared with healthy controls (1366±187 versus 686±167U/g protein; P =0.01). An inverse correlation between MnSOD activity and relative mtDNA amplification was detected on analysis of the diabetic patients and controls (r =−0.57; P =0.02) (Fig. 2). However, when the patients and healthy controls were analysed separately, this relationship was lost.

Respiratory-chain enzyme

No differences in mitochondrial respiratory-chain function (COX activity per milligram of protein or by mitochondrial content) between diabetic patients and controls were found (Table 2).

Discussion

In the present study, we found a higher degree of mtDNA oxidative damage as well as an increase in antioxidant status in PBMCs from type 2 diabetic patients with diabetic complications in comparison to healthy subjects. The correlation between mtDNA content and mtDNA relative amplification suggests that oxidative stress is a main contributor to the depletion of mtDNA observed in diabetic patients. The increase in MnSOD activity detected in diabetic PBMCs was inversely related to the relative mtDNA amplification, thus supporting the concept that MnSOD is upregulated by oxidative stress. In addition, these findings provide evidence that a reduction of MnSOD activity is not primarily involved in the oxidative damage detected in type 2 diabetic patients. However, the increase of MnSOD activity was not enough to counterbalance the degree of oxidative stress and so avoid mtDNA depletion. It must be emphasised that these findings have been detected in PBMCs, which have a rapid turnover, thus preventing accumulation of mtDNA abnormalities. Therefore, it may be that mtDNA oxidative damage could be even more exaggerated in tissues as a consequence of long-term oxidative stress such as seen with late diabetic complications.

Previous reports have shown a higher accumulation of the A3243G point mutation and somatic transversion point mutations of mtDNA in PBMCs of type 2 diabetic patients compared with healthy subjects [32 and 33]. Furthermore, significant decreases in mtDNA content in PBMCs from both type 1 and type 2 diabetic patients, and also in the peripheral blood of the offspring of type 2 diabetic patients, have been demonstrated [34 and 35]. Unfortunately, measurements of oxidative stress were not reported in those studies.

Oxidative DNA damage has been found to be increased in leukocytes from type 1 and type 2 diabetic patients in comparison to healthy controls [36 and 37]. However, in those studies, mtDNA and MnSOD were not analysed. In the present study, mtDNA oxidation was determined by an indirect method based on the premise that DNA lesions result in decreased DNA amplification. Therefore, apart from oxidative damage, other DNA lesions might eventually affect the results. Advanced glycation end-products (AGEs) have been involved in DNA damage [38]. However, a significant contribution of AGEs to mtDNA impairment in cells with rapid turnovers such as PBMCs seems unlikely. In addition, in the present study, the 4977-bp common deletion was ruled out. Furthermore, patients with other oxidative stress conditions such as renal failure or a smoking habit were excluded from the study. Therefore, it may be assumed that mtDNA oxidation secondary to the diabetic milieu is the main factor accounting for the reduced mtDNA amplification in PBMCs detected in diabetic patients.

Two previous reports have investigated the mitochondrial fraction of SOD in the peripheral blood cells of diabetic patients, and both found a significant decrease in MnSOD activity in diabetics [39 and 40]. However, in our study, a significant increase in MnSOD activity was found in the PBMCs of the diabetic patients. However, both methodological and clinical differences among these studies may explain the conflicting results. Although similar methods were used to determine enzyme activity in these studies, there were discrepancies in terms of sample collection and blood-cell separation. More important, the diabetic patients were different in terms of age, duration of diabetes and presence of vascular complications. It is worth noting that, in the cohort reported by Uchimura et al. [40], patients were 15 years younger than those included in our study. In addition, the diabetic patients included in the present study suffered from several micro- and macrovascular complications, reflecting a higher degree of oxidative damage. As MnSOD is an inducible enzyme upregulated by oxidative stress [41], it is to be expected that the higher the oxidative stress, the higher the degree of MnSOD activity. In fact, MnSOD activity is used as an indirect measurement of oxidative stress [41]. However, measurements of oxidative stress were not provided in the two studies previously mentioned [39 and 40]. We have recently demonstrated that cybrids harbouring mutations in mtDNA show an increased rate of ROS production, with a parallel increase in the activity of several antioxidant enzymes, which can protect cells from oxidative damage [42]. Thus, the elevated MnSOD activity found in our diabetic group may point to an adaptive reaction to oxidative stress due to free radical overproduction and increased enzyme biosynthesis.

It has also been suggested that mitochondria are important in the activation of NFκB, a protein that plays a central role in the regulation of many of the genes involved in cellular defence mechanisms, pathogen defences, immunological responses, and the expression of cytokines and cell-adhesion molecules. The ROS generated in the mitochondrial respiratory chain have been proposed as being the intermediate messengers involved in the activation of NFκB by TNF and IL-1 [13, 14 and 15]. It is possible that the relative balance between the stimuli of mitochondrial oxidant production and the concomitant accumulation of organellar damage can ultimately influence cellular response and function. Consequently, mitochondrial damage may serve as a general, yet direct, indicator or predictor of mitochondrial dysfunction. Thus, the mtDNA oxidative damage detected in the present study could contribute to the immune deficits described in diabetic patients as well as to the development of diabetic complications. Reestablishment of the balance between oxidative stress and antioxidant defences in the mitochondria may well be crucial for normalisation of mitochondrial function as well as preventing diabetes complications. Nishikawa et al. [4] have shown that normalising mitochondrial ROS levels by overexpressing MnSOD in endothelial cells prevents high glucose-induced activation of at least three different pathological pathways related to late diabetic complications. Shen et al. [43] recently demonstrated that overexpression of MnSOD in the hearts of transgenic mice completely reversed diabetes-damaged cardiac morphology and impaired contractility. In addition, Kowluru et al. [44] showed that overexpression of MnSOD in mice protects the retina from diabetes-induced oxidative stress.

Finally, the increased degree of mtDNA oxidation with the decreased amount of mtDNA observed in diabetic subjects in comparison to the healthy controls was not associated with a decrease in COX activity (complex IV of the mitochondrial respiratory chain). It should be noted that mtDNA damage of more than 80% is necessary to induce mitochondrial respiratory-chain dysfunction [45 and 46]. In the present study, the reduction of mtDNA content in diabetic patients was only 23%; therefore, as expected, there was no effect on COX activity.

In summary, in the present study, we demonstrated an increased amount of mtDNA oxidative damage in PMBCs from type 2 diabetic patients with late diabetic complications in comparison to healthy subjects. The degree of mtDNA oxidation was associated with a reduction of mtDNA content as well as an increase of MnSOD as an adaptive response against oxidative stress. Whether these mitochondrial alterations on PMBCs could have an effect on their functioning, thereby explaining the increased susceptibility of diabetic patients to certain infections, and/or contribute to the development of late diabetic complications remains to be elucidated.


Acknowledgments

This study was supported by grants from Lilly S.A. and the Ministerio de Sanidad y Consumo, Instituto de Salud Carlos III (CIBERDEM). We thank David Lligé for his technical assistance.



References

Ceriello A. New insights on oxidative stress and diabetic complications may lead to a “causal” antioxidant therapy Diabetes Care 2003 ;  26 : 1589-1596 [cross-ref]
Brownlee M. Biochemistry and molecular cell biology of diabetic complications Nature 2001 ;  414 : 813-820 [cross-ref]
Ceriello A., Bortolotti N., Crescentini A., Motz E., Lizzio S., Russo A., et al. Antioxidant defences are reduced during the oral glucose tolerance test in normal and non-insulin-dependent diabetic subjects Eur J Clin Invest 1998 ;  28 : 329-333 [cross-ref]
Nishikawa T., Edelstein D., Du X.L., Yamagishi S., Matsumura T., Kaneda Y., et al. Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage Nature 2000 ;  404 : 787-790
Kiritoshi S., Nishikawa T., Sonoda K., Kukidome D., Senokuchi T., Matsuo T., et al. Reactive oxygen species from mitochondria induce cyclo-oxygenase-2 gene expression in human mesangial cells: potential role in diabetic nephropathy Diabetes 2003 ;  52 : 2570-2577 [cross-ref]
Piconi L., Quagliaro L., Assaloni R., Da Ros R., Maier A., Zuodar G., et al. Constant and intermittent high glucose enhances endothelial cell apoptosis through mitochondrial superoxide overproduction Diabetes Metab Res Rev 2006 ;  22 : 198-203 [cross-ref]
Dandona P., Thusu K., Cook S., Snyder B., Makowski J., Armstrong D., et al. Oxidative damage to DNA in diabetes mellitus Lancet 1996 ;  347 : 444-445 [cross-ref]
Seghrouchni I., Drai J., Bannier E., Riviere J., Calmard P., Garcia I., et al. Oxidative stress parameters in type I, type II and insulin-treated type 2 diabetes mellitus; insulin treatment efficiency Clin Chim Acta 2002 ;  321 : 89-96 [cross-ref]
Ceriello A., Mercuri F., Quagliaro L., Assaloni R., Motz E., Tonutti L., et al. Detection of nitrotyrosine in the diabetic plasma: evidence of oxidative stress Diabetologia 2001 ;  44 : 834-838
Bohr V.A., Anson R.M. DNA damage, mutation and fine structure DNA repair in aging Mutat Res 1995 ;  338 : 25-34 [cross-ref]
Vincent A.M., Brownlee M., Russell J.W. Oxidative stress and programmed cell death in diabetic neuropathy Ann N Y Acad Sci 2002 ;  959 : 368-383
Kowluru R.A., Atasi L., Ho Y.S. Role of mitochondrial superoxide dismutase in the development of diabetic retinopathy Invest Ophthalmol Vis Sci 2006 ;  47 : 1594-1599 [cross-ref]
Devary Y., Rosette C., DiDonato J.A., Karin M. NF-kappa B activation by ultraviolet light not dependent on a nuclear signal Science 1993 ;  261 : 1442-1445
Mohan N., Meltz M.M. Induction of nuclear factor kB after low-dose ionizing radiation involves a reactive oxygen intermediate signaling pathway Radiat Res 1994 ;  140 : 97-104 [cross-ref]
Schulze-Osthoff K., Los M., Baeuerle P.A. Redox signaling by transcription factors NF-κB and AP-1 in lymphocytes Biochem Pharmacol 1995 ;  50 : 735-741 [cross-ref]
Kimura F., Hasegawa G., Obayashi H., Adachi T., Hara H., Ohta M., et al. Serum extracellular superoxide dismutase in patients with type 2 diabetes: relationship to the development of micro- and macrovascular complications Diabetes Care 2003 ;  26 : 1246-1250 [cross-ref]
Zitouni K., Nourooz-Zadeh J., Harry D., Kerry S.M., Betteridge D.J., Capuccio F.P., et al. Race-specific differences in antioxidant enzyme activity in patients with type 2 diabetes: a potential association with the risk of developing nephropathy Diabetes Care 2005 ;  28 : 1698-1703 [cross-ref]
Kesavulu M.M., Giri R., Kameswara Rao B., Apparao C. Lipid peroxidation and antioxidant enzyme levels in type 2 diabetics with microvascular complications Diabetes Metab 2000 ;  26 : 387-392 [inter-ref]
Bhatia S., Shukla R., Venkata Madhu S., Kaur Gambhir J., Madhava Prabhu K. Antioxidant status, lipid peroxidation and nitric oxide end products in patients of type 2 diabetes mellitus with nephropathy Clin Biochem 2003 ;  36 : 557-562 [cross-ref]
Vucic M., Gavella M., Bozikov V., Aschcroft S.J., Rocic B. Superoxide dismutase activity in lymphocytes and polymorphonuclear cells of diabetic patients Eur J Clin Chem Clin Biochem 1997 ;  35 : 517-521
Stephens J.W., Gable D.R., Hurel S.J., Miller G.J., Cooper J.A., Humphries S.E. Increased plasma markers of oxidative stress are associated with coronary heart disease in males with diabetes mellitus and with 10-year risk in a prospective sample of males Clin Chem 2006 ;  52 : 446-452 [cross-ref]
Ziegler D., Sohr C.G., Nourooz-Zadeh J. Oxidative stress and antioxidant defense in relation to the severity of diabetic polyneuropathy and cardiovascular autonomic neuropathy Diabetes Care 2004 ;  27 : 2178-2183 [cross-ref]
Dragsted L.O., Pedersen A., Hermetter A., Basu S., Hansen M., Haren G.R., et al. The 6-a-day study: effects of fruit and vegetables on markers of oxidative stress and antioxidative defense in healthy nonsmokers Am J Clin Nutr 2004 ;  79 : 1060-1072
Sen C. Oxidants and antioxidants in exercise J Appl Physiol 1995 ;  79 : 675-686
American Diabetes Association Diagnosis and classification of diabetes mellitus Diabetes Care 2006 ;  29 : S43-S48
Gonzalo R., García-Arumí E., Lligé D., Martí R., Solano A., Montoya J., et al. Free radicals-mediated damage in transmitochondrial cells harboring the T14487C mutation in the ND6 gene of mtDNA FEBS Lett 2005 ;  579 : 6909-6913 [cross-ref]
Santos J.H., Mandavilli B.S., Van Houten B. Measuring oxidative mtDNA damage and repair using quantitative PCR Methods Mol Biol 2002 ;  197 : 159-176 [cross-ref]
Kalinowski D., Illenye S., Van Houten B. Analysis of DNA damage and repair in murine leukemia L1210 cells using a quantitative polymerase chain reaction assay Nucleic Acid Res 1992 ;  20 : 3485-3494
McCord J.M., Fridovich I. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein) J Biol Chem 1969 ;  244 : 6049-6055
Rustin P., Chretien D., Bourgeron T., Gerard B., Rötig A., Saudubray J.M., et al. Biochemical and molecular investigations in respiratory chain deficiencies Clin Chim Acta 1994 ;  228 : 35-51 [cross-ref]
Srere P.A. Citrate synthase Methods Enzymol 1969 ;  13 : 3-11 [cross-ref]
Nomiyama T., Tanaka Y., Hattori N., Nishimaki K., Nagasaka K., Kawamori R., et al. Accumulation of somatic mutation in mitochondrial DNA extracted from peripheral blood cells in diabetic patients Diabetologia 2002 ;  45 : 1577-1583
Kamiya J., Aoki Y. Associations between hyperglycaemia and somatic transversion mutations in mitochondrial DNA of people with diabetes mellitus Diabetologia 2003 ;  46 : 1559-1566 [cross-ref]
Song J., Young J., Sung Y.A., Park Y.K., Park K.S., Lee H.K. Peripheral blood mitochondrial DNA content is related to insulin sensitivity in offspring of type 2 diabetic patients Diabetes Care 2001 ;  24 : 865-869 [cross-ref]
Lee H.K., Song J.H., Shin C.S., Park D.J., Park K.S., Lee K.U., et al. Decreased mitochondrial DNA content in peripheral blood precedes the development of non-insulin-dependent diabetes mellitus Diabetes Res Clin Pract 1998 ;  42 : 161-167 [cross-ref]
Dincer Y., Akcay T., Ilkova H., Alademir Z., Ozbay G. DNA damage and antioxidant defense in peripheral leukocytes of patients with type I diabetes mellitus Mutat Res 2003 ;  527 : 49-55 [cross-ref]
Pitozzi V., Giovannelli L., Bardini G., Rotella C.M., Dolara P. Oxidative DNA damage in peripheral blood cells in type 2 diabetes mellitus: higher vulnerability of polymorphonuclear leukocytes Mutat Res 2003 ;  529 : 129-133 [cross-ref]
Stitt A.W., Jenkins A.J., Cooper M.E. Advanced glycation end products and diabetic complications Expert Opin Investig Drugs 2002 ;  11 : 1205-1223 [cross-ref]
Nath N., Chari S.N., Rathi A.B. Superoxide dismutase in diabetic polymorphonuclear leukocytes Diabetes 1984 ;  33 : 586-589
Uchimura K., Nagasaka A., Hayashi R., Makino M., Nagata M., Kakizawa H., et al. Changes in superoxide dismutase activities and concentrations and myeloperoxidase activities in leukocytes from patients with diabetes mellitus J Diab Compl 1999 ;  13 : 264-270 [cross-ref]
MacMillan-Crow L.A., Cruthirds D.L. Manganese superoxide dismutase in disease Free Radic Res 2001 ;  34 : 325-336 [cross-ref]
Vives-Bauza C., Gonzalo R., Manfredi G., García-Arumí E., Andreu A.L. Enhanced ROS production and antioxidant defenses in cybrids harbouring mutations in mtDNA Neurosci Lett 2006 ;  391 : 136-141 [cross-ref]
Shen X., Zheng S., Metrevell N.S., Epstein P.N. Protection of cardiac mitochondria by overexpression of MnSOD reduces diabetic cardiomyopathy Diabetes 2006 ;  55 : 798-805 [cross-ref]
Kowluru R.A., Kowluru V., Xiong Y., Ho Y.S. Overexpression of mitochondrial superoxide dismutase in mice protects the retina from diabetes-induced oxidative stress Free Radic Biol Med 2006 ;  41 : 1191-1196 [cross-ref]
Boulet L., Karpati G., Shoubridge E.A. Distribution and threshold expression of the tRNA(Lys) mutation in skeletal muscle of patients with myoclonic epilepsy and ragged-red fibers (MERRF) Am J Hum Genet 1992 ;  51 : 1187-1200
Sciacco M., Bonilla E., Schon E.A., DiMauro S., Moraes C.T. Distribution of wild-type and common deletion forms of mtDNA in normal and respiration-deficient muscle fibers from patients with mitochondrial myopathy Hum Mol Genet 1994 ;  3 : 13-19



© 2008  Elsevier Masson SAS. Tous droits réservés.
Site e-commerce : www.elsevier-masson.fr | Service d'aide à la décision clinique : www.em-select.com | Suivez notre actualité sur le blog Elsevier Masson : blog.elsevier-masson.fr
EM-CONSULTE.COM est déclaré à la CNIL, déclaration n° 1286925.
En application de la loi nº78-17 du 6 janvier 1978 relative à l'informatique, aux fichiers et aux libertés, vous disposez des droits d'opposition (art.26 de la loi), d'accès (art.34 à 38 de la loi), et de rectification (art.36 de la loi) des données vous concernant. Ainsi, vous pouvez exiger que soient rectifiées, complétées, clarifiées, mises à jour ou effacées les informations vous concernant qui sont inexactes, incomplètes, équivoques, périmées ou dont la collecte ou l'utilisation ou la conservation est interdite.
Les informations personnelles concernant les visiteurs de notre site, y compris leur identité, sont confidentielles.
Le responsable du site s'engage sur l'honneur à respecter les conditions légales de confidentialité applicables en France et à ne pas divulguer ces informations à des tiers.
Fermer
Plan de l'article