Article

PDF
Access to the PDF text
Service d'aide à la décision clinique
Advertising


Free Article !

Journal Français d'Ophtalmologie
Vol 28, N° 4  - avril 2005
pp. 386-390
Doi : JFO-04-2005-28-4-0181-5512-101019-200503684
Étude de l’association entre la rétinopathie diabétique et un polymorphisme du gène de l’aldose réductase dans la population tunisienne
 

I. Zghal-Mokni [1], I. Arfa [2], H. Elloumi-Zghal [2], A. Abid [1], C. Amrouche-Rached [1], B. Kaabi [2], S. Chakroun [2], S. Blousa-Chabchoub [1], S. Gaïgi [1], S. Ayed [3], A. Jeddi [4], K. Dellagi [2], S. Abdelhak [2]
[1] Institut National de Nutrition, Tunis, Tunisie.
[2] Institut Pasteur, Tunis, Tunisie.
[3] Institut Hédi Raïs d’Ophtalmologie, Tunis, Tunisie.
[4] Service d’Ophtalmologie, CHU La Rabta, Tunis, Tunisie.

Tirés à part : S. Abdelhak,

[5] Institut Pasteur de Tunis, BP74, 13, Place Pasteur, 1002 Tunis Belvédère, Tunisie. sonia.abdelhak@pasteur.rns.tn

Communication affichée lors du 109e congrès de la SFO en mai 2003. * Contribution égale.


@@#100979@@
Étude de l’association entre la rétinopathie diabétique et un polymorphisme du gène de l’aldose réductase dans la population tunisienne

Introduction : L’aldose réductase est une enzyme clé impliquée dans la voie des polyols. Il a été suggéré qu’elle contribue à la pathogénie des complications microangiopathiques du diabète notamment la rétinopathie. Le but de cette étude est de déterminer si le gène de l’aldose réductase (ALR2) est impliqué dans la susceptibilité génétique à la rétinopathie diabétique chez la population tunisienne.

Matériel et méthodes : La stratégie utilisée est celle d’une étude cas-témoin. Nous avons comparé un groupe de 47 patients atteints d’un diabète de type 2 ayant une rétinopathie et un groupe de 28 diabétiques de type 2 qui en étaient exempts malgré un diabète évoluant depuis plus de 5 ans et plus de 10 ans chez 13 des 28 cas. Nous avons testé la contribution d’un polymorphisme microsatellite de type (CA)n localisée à 2,1 kb en amont du gène ALR2 dans la susceptibilité à la rétinopathie diabétique. L’analyse statistique des résultats était réalisée grâce au logiciel Epi info (version 6.01) ; les données étaient comparées en utilisant le test χ2.

Résultats : Le génotypage des 2 groupes diabétiques (avec ou sans rétinopathie) ne montrait pas d’association entre les allèles de ce marqueur et la rétinopathie diabétique dans l’échantillon étudié.

Discussion : Une association entre l’allèle Z – 2 de ce microsatellite et la rétinopathie diabétique a été rapportée chez des diabétiques de type 2 chinois et japonais, les différentes études de l’implication de ce polymorphisme dans la rétinopathie diabétique sont divergentes. L’absence de liaison entre la rétinopathie diabétique et les allèles de l’ALR2 indique que le gène de l’aldose réductase ne contribuerait pas dans la susceptibilité génétique à la rétinopathie diabétique chez les diabétiques de type 2 dans la population tunisienne étudiée.

Abstract
Association study between diabetic retinopathy and aldose reductase gene polymorphism in Tunisians

Introduction: Aldose reductase (ALR2), the enzyme of the polyol pathway, may play an important role in the pathogenesis of diabetic microvascular complications, namely diabetic retinopathy. The study aimed to determine whether the aldose reductase gene is involved in diabetic retinopathy in the Tunisian population.

Material and methods: A case-control study was conducted in 47 type 2 diabetic patients who have diabetic retinopathy and 28 diabetic patients without diabetic retinopathy in spite of diabetes lasting for more than 5 years and over 10 years in 13 cases. We investigated the association between the (CA)n polymorphism located at 2.1 kb upstream of the transcription start site of ALR2 and diabetic retinopathy. The distribution of genotypes and alleles was compared between cases and controls by χ2 test using Epi info software.

Results: Genotyping of the two groups did not demonstrate any association between the alleles of this marker and diabetic retinopathy in the Tunisian population studied.

Discussion: An association between one of the alleles (Z –  2) of this microsatellite and diabetic retinopathy was identified in Chinese and Japanese patients with type 2 diabetes. Discordant results were obtained for the different populations studied. The lack of an association between diabetic retinopathy and ALR2 alleles indicates that the ALR2 gene is not a genetic marker of predisposition to diabetic retinopathy for type 2 diabetic patients in the Tunisian population studied.


Mots clés : Rétinopathie diabétique , gène , aldose réductase

Keywords: Diabetic retinopathy , gene , aldose reductase


INTRODUCTION

L’aldose réductase est une enzyme clé impliquée dans la voie des polyols. Il a été suggéré qu’elle contribue à la pathogénie des complications microangiopathiques du diabète, notamment la rétinopathie.

Chez le sujet normal, cette voie est accessoire. En cas d’hyperglycémie, elle s’active et transforme le glucose en sorbitol par l’aldose réductase, puis le sorbitol en fructose par le sorbitol déshydrogénase. Le sorbitol et le fructose sont peu métabolisés et peu diffusibles [1], [2]. Il s’ensuit une accumulation de radicaux libres toxiques pour la cellule.

En 1991, Graham et al. [3] ont déterminé la structure et la séquence du gène de l’aldose réductase qui s’étend approximativement sur 18 kb au niveau du bras long du Chromosome 7 à la position q35. Il est constitué de 10 exons et code pour une protéine formée de 316 acides aminés.

Un polymorphisme microsatellite de type répétition dinucléotidique (CA)n situé à 2,1 kb du début du site d’initiation de la transcription du gène de l’aldose réductase a été identifié. Il a été testé dans les complications microvasculaires du diabète de type 2 et de type 1 [4], [5].

L’objectif de ce travail est d’étudier les facteurs génétiques impliqués dans la susceptibilité à la rétinopathie diabétique chez des diabétiques de type 2 de la population tunisienne.

PATIENTS ET MÉTHODES
Population étudiée

Il s’agit d’une étude cas-témoin. Soixante-quinze patients diabétiques de type 2 ont été recrutés à l’Institut National de Nutrition de Tunis et classés en 2 sous-groupes :

  • 47 patients ayant une rétinopathie diabétique (RD) non proliférante sévère dans 17 cas ou une RD proliférante dans 28 cas ;
  • 28 diabétiques sans rétinopathie diabétique malgré une durée du diabète de plus de 5 ans et plus de 10 ans dans 13 cas. Ce biais de sélection a été introduit afin de minimiser la contribution des facteurs environnementaux et, en particulier, celle de la rétinopathie liée à la durée du diabète.

Tous les patients ont eu un examen du fond d’œil avec une angiographie rétinienne. La classification de la RD s’est faite selon l’ETDRS [6].

Génotypage du polymorphisme 5’-ALR2 (CA)n

L’ADN génomique a été extrait à partir de leucocytes isolés à partir du sang total par les méthodes classiques d’extraction au phénol/chloroforme. Le polymorphisme était ensuite amplifié en utilisant l’amplification enzymatique par réaction de polymérisation en chaîne (PCR) à l’aide des amorces suivantes (fig. 1) :

  • Sens : GAATCTTAACATGCTCTGAAC
  • Anti-sens : GCCCAGCCCTATACCTAGT

La réaction de PCR était effectuée dans un thermocycleur, Applied Biosystems 9700 dans un volume final de 50 µl contenant au moins : 250 ng d’ADN génomique, 10 µM de chaque amorce, 250 µM de désoxyribonucléotide triphosphate, 1,5 mM de MgCl2 et une unité de la Taq polymerase.

L’amplification était réalisée durant 40 cycles d’une minute de dénaturation à 94 °C, une minute d’hybridation à 61 °C et une minute d’extension à 72 °C.

Un dernier cycle à 72 °C pendant 7 minutes permettait la fin de l’élongation et achèvait ainsi la réaction de PCR. Les allèles présents étaient ensuite séparés par électrophorèse sur gel dénaturant de polyacrylamide à 6 %. Les produits d’amplification étaient transférés sur une membrane de nylon chargée positivement, puis hybridés avec une sonde poly AC marquée avec du d-CTP-αP32(fig. 2).

Analyse statistique des résultats

L’analyse statistique des résultats était réalisée grâce au logiciel Epi info (version 6.01) ; les données étaient comparées en utilisant le test du χ2.

RÉSULTATS

Un nombre total de 9 allèles était observé Z – 8, Z – 6, Z – 4, Z – 2, Z, Z + 2, Z + 4, Z + 6 et Z + 8 correspondant respectivement à 20, 21, 22, 23, 24, 25, 26, 27 et 28 répétitions. L’allèle Z (138 Pb) étant l’allèle le plus fréquent, suivi des allèles Z – 2 et Z + 2.

Ces trois allèles (Z – 2, Z, Z + 2) représentaient 79,3 % du nombre total d’allèles observés dans les deux groupes combinés. La distribution des allèles de ce marqueur chez les sujets diabétiques de type 2 est indiquée dans le tableau I.

La distribution des génotypes comprenant l’allèle Z + 2 et l’allèle Z – 2 est rapportée dans le tableau II.

La distribution des allèles Z – 2 et Z + 2 de ce marqueur ainsi que celle des génotypes comprenant ces allèles ne montraient pas de différence statistiquement significative entre les patients diabétiques présentant une complication rétinienne et ceux qui en étaient exempts.

D’après cette étude, le polymorphisme microsatellite situé dans la région 5’ du gène de l’aldose réductase ne contribuerait pas dans la susceptibilité à la rétinopathie diabétique chez les diabétiques de type 2 dans la population tunisienne étudiée.

DISCUSSION

L’association entre la RD et les allèles de l’ALR2 a été décrite aussi bien chez des patients diabétiques de type 2 chinois [7] et japonais [8] que chez des diabétiques de type 1 australiens [9], américains du nord et européens [10].

L’allèle Z – 2 a été décrit comme étant associé avec la RD dans différentes populations telles que les Indiens asiatiques [11], ainsi que chez des diabétiques de type 2 de la population chinoise [12]. En revanche, d’autres études chez des diabétiques de type 1 caucasiens [13], [14] et caucasiens britanniques [5], ainsi que chez des diabétiques de type 2 coréens [15] n’ont pas rapporté d’association entre la RD et les allèles de l’ALR2 comme dans cette étude. La divergence des résultats peut être due à la différence de l’origine géographique des patients testés (différence ethnique), à la taille de l’échantillon étudié, ainsi qu’aux critères de choix des témoins et des cas.

Pour cette étude, l’échantillon étudié étant de petite taille ce n’est pas possible de conclure sur une éventuelle association avec le marqueur ALR2. En effet pour l’allèle Z + 2, nous retrouvons un OR de 0,62 et donc une tendance à un rôle protecteur de cet allèle, ce qui rejoint les données rapportées dans la littérature [5].

Par ailleurs, les polymorphismes au niveau d’autres gènes candidats peuvent être impliqués. Par exemple, le polymorphisme I/D au niveau de l’intron 16 du gène ACE a été rapporté comme étant associé avec la rétinopathie chez des diabétiques de type 2 de la population japonaise [16] et chez des diabétiques de type 1 de la population caucasienne [17], ainsi que le polymorphisme 4G/5G du gène PAI-1 qui serait associé avec la rétinopathie diabétique chez des Indiens pima diabétiques de type 2 [18].

Néanmoins, certains facteurs environnementaux tels que l’équilibre glycémique et la durée du diabète joueraient un rôle dans l’apparition de la RD. Toutefois, l’existence d’une RD au moment du diagnostic du diabète de type 1 [19], suggère l’implication de facteurs génétiques.

Dans les modèles expérimentaux, l’ALR2 est impliqué dans la pathogénie de la cataracte diabétique, de la neuropathie et de la néphropathie ainsi que de la RD. En effet, les inhibiteurs de l’ALR2 administrés à des animaux ayant un diabète induit peuvent éliminer ou retarder l’apparition de ces complications [20]. Cependant, les résultats des études cliniques de ces médicaments ne sont pas concluants [21]. Ainsi, le rôle de l’ALR2 dans les complications du diabète dans l’espèce humaine demeure inconnu.

L’ALR2 serait responsable uniquement dans les premiers stades de la pathogénie de ces complications [7].

CONCLUSION

L’étude que nous avons menée chez les diabétiques de type 2 de la population tunisienne n’a pas permis de détecter d’association entre la rétinopathie diabétique et les allèles de l’ALR2. Ces résultats suggèrent que le gène de l’ALR2 n’est pas un marqueur de prédisposition génétique à la rétinopathie diabétique chez les diabétiques de type 2, dans l’échantillon étudié de la population tunisienne.

Il est possible que d’autres gènes majeurs soient impliqués dans la rétinopathie diabétique et/ou que des facteurs environnementaux prédominent dans cette population. D’où la nécessité d’explorer d’autres gènes candidats, notamment l’ACE qui code pour l’enzyme de conversion de l’angiotensine.

Références

[1]
Bosquet F, Grimaldi A. Rôle de la voie des polyols dans la survenue des complications dégénératives du diabète. Presse Med, 1986;15:879-83.
[2]
Dvornik D. Hyperglycemia in the pathogenesis of diabetic complications. In : Aldose reductase inhibition: an approach to the prevention of diabetic complications. Porte D, Ed New York, Mc Graw Hill, 1987:7-151.
[3]
Graham A, Heath P, Morten JE, Markham AF. The human aldose reductase gene maps to chromosome region 7q35. Human Genet, 1991;86:509-14.
[4]
Liu YF, Wat NM, Chung SS, Ko BC, Lam KS. Diabetic nephropathy is associated with the 5’-end dinucleotide repeat polymorphism of the aldose reductase gene in chinese subjects with type2 diabetes. Diabet Med, 2002;19:113-8.
[5]
Heesom AE, Hibberd ML, Millward A, Demaine AG. Polymorphism in the 5’-end of the aldose reductase gene is strongly associated with the development of diabetic nephropathy in typeI diabetes. Diabetes, 1997;46:287-91.
[6]
Early Treatment Diabetic Retinopathy Study Research Group. Grading diabetic retinopathy from stereoscopic color fundus photographs. An extension of the modified airlie house classification-ETDRS. Ophthalmology, 1991;98:786-806.
[7]
Ko BC, Lam KS, Wat NM, Chung SS. An (A-C)n dinucleotide repeat polymorphic marker at the 5’ End of the Aldose reductase gene is associated with early-onset diabetic retinopathy in NIDDM patients. Diabetes, 1995;44:727-32.
[8]
Ichikawa F, Yamada K, Ishiyama-Shigemoto S, Yuan X, Nonaka K. Association of an (A-C)n dinucleotide repeat polymorphic marker at the 5’-region of the aldose reductase gene with retinopathy but not with nephropathy or neuropathy in japanese patients with Type 2 diabetes mellitus. Diabet Med, 1999;16:744-8.
[9]
Kao YL, Donaghue K, Chan A, Knight J, Silink M. A novel polymorphism in the aldose reductase gene promoter region is strongly associated with diabetic retinopathy in adolescents with type 1 diabetes. Diabetes, 1999;48:1338-40.
Demaine A, Cross D, Millward A. Polymorphisms of the Aldose reductase gene and susceptibility to retinopathy in type 1 diabetes mellitus. Invest Ophthalmol Vis Sci, 2000;41:4064-8.
Kumaramanickavel G, Sripriya S, Ramprasad VL, Upadyay NK, Paul PG, Sharma T. Z – 2 aldose reductase allele and diabetic retinopathy in India. Ophthalmic Genet, 2003;24:41-8.
Wang Y, Ng MC, Lee SC, So WY, Tong PC, Cockram CS et al. Phenotypic heterogeneity and associations of two aldose reductase gene polymorphisms with nephropathy and retinopathy in type2 diabetes. Diabetes Care, 2003;26:2410-5.
Ng DPK, Conn J, Chung SS, Larkins RG. Aldose reductase (AC)n microsatellite polymorphism and diabetic microvascular complications in caucasian type 1 diabetes mellitus. Diabetes Res Clin Practice, 2001;52:21-27.
Fanelli A, Hadjadj S, Gallois Y, Fumeron F, Betoule D, Grandchamp B et al. Polymorphisme du gène de l’aldose réductase et susceptibilité à la rétinopathie et à la néphropathie chez des caucasiens diabétiques de type1. Archives des Maladies du Cœur et des Vaisseaux, 2002;95:701-8.
Park HK, Ahn CW, Lee GT, Kim SJ, Song YD, Lim SK et al. (AC)(n) polymorphism of aldose reductase gene and diabetic microvascular complications in type 2 diabetes mellitus. Diabetes Res Clin Pract, 2002;55:151-7.
Matsumoto A, Iwashima Y, Abiko A, Morikawa A, Sekiguchi M, Eto M et al. Detection of the association between a deletion polymorphism in the gene encoding angiotensin I-converting enzyme and advanced diabetic retinopathy. Diabetes Res Clin Pract. 2000;50:195-202.
Rabensteiner D, Abrahamian H, Irsigler K, Hermann KM, Kiener HP, Mayer G, et al. ACE gene polymorphism and proliferative retinopathy in type 1 diabetes: results of a case-control study. Diabetes Care, 1999;22:1530-5.
Nagi DK, McCormack LJ, Mohamed-Ali V, Yudkin JS, Knowler WC, Grant PJ. Diabetic retinopathy, promoter (4G/5G) polymorphism of PAI-1 gene, and PAI-1 activity in Pima Indians with type 2 diabetes. Diabetes Care, 1997;20:1304-9.
Zghal-Mokni I, Jeddi A, Malouche N, Hadj Alouane W, Gaigi S, Ayed S. Rétinopathie diabétique concomitante du diagnostic de diabète de type I. J Fr Ophtalmol, 2003;26:734-7.
Kador PF, Akagi Y, Takahashi Y, Ikebe H, Wyman M, Kinoshita JH. Prevention of retinal vessel changes associated with diabetic retinopathy in galactose-fed dogs by aldose reductase inhibitors. Arch Ophthalmol, 1990;108:1301-9.
Sorbinil retinopathy trial research group: the sorbinil retinopathy trial: neuropathy results. Neurology, 1993;43:1141-9.




© 2005 Elsevier Masson SAS. Tous droits réservés.
EM-CONSULTE.COM is registrered at the CNIL, déclaration n° 1286925.
As per the Law relating to information storage and personal integrity, you have the right to oppose (art 26 of that law), access (art 34 of that law) and rectify (art 36 of that law) your personal data. You may thus request that your data, should it be inaccurate, incomplete, unclear, outdated, not be used or stored, be corrected, clarified, updated or deleted.
Personal information regarding our website's visitors, including their identity, is confidential.
The owners of this website hereby guarantee to respect the legal confidentiality conditions, applicable in France, and not to disclose this data to third parties.
Close
Article Outline