Article

PDF
Access to the PDF text
Service d'aide à la décision clinique
Advertising


Free Article !

Journal Français d'Ophtalmologie
Volume 33, n° 6
pages 383-390 (juin 2010)
Doi : 10.1016/j.jfo.2010.03.014
Received : 30 November 2009 ;  accepted : 11 Mars 2010
Apport de la microscopie confocale in vivo au diagnostic des kératites amibiennes
In vivo confocal microscopy: A new tool for the diagnosis of Acanthamoeba keratitis
 

A. Grise-Dulac a, , b , E. Brasnu a, b, P. Goldchmidt c, B. Dupas a, A. Labbe a, b, V. Borderie d, E. Borsali c, C. Chaumeil c, C. Baudouin a, b
a Service III, Centre hospitalier national d’ophtalmologie des Quinze-Vingts, 28, rue de Charenton, 75012 Paris, France 
b Inserm UMRS 968, institut de la vision, université Pierre-et-Marie-Curie Paris 6, 75012 Paris, France 
c Laboratoire, Centre hospitalier national d’ophtalmologie des Quinze-Vingts, Paris, France 
d Fédération des pathologies infectieuses oculaires, Centre hospitalier national d’ophtalmologie des Quinze-Vingts, 75012 Paris, France 

Auteur correspondant.
Résumé
Introduction

Les kératites amibiennes sont des infections sévères survenant principalement chez les patients porteurs de lentilles de contact. La rapidité du diagnostic et du traitement demeure un élément pronostic majeur. Le but de cette étude était d’évaluer l’intérêt de la microscopie confocale in vivo, technique directe et non invasive, pour la prise en charge de ces patients.

Matériel et méthodes

Les dossiers de 50 cas (yeux) de kératites avec suspicion d’infection amibienne suivis au Centre hospitalier national d’ophtalmologie des Quinze-Vingts entre janvier 2005 et juillet 2008 ont été analysés. Tous les patients ont eu un examen ophtalmologique complet, des prélèvements de cornée ainsi qu’un examen en microscopie confocale in vivo (Heidelberg Retina Tomograph – Rostock Cornea Module) à la recherche d’images évocatrices de kystes amibiens.

Résultats

Quarante-deux des 50 cas de kératites étaient survenus chez des patients porteurs de lentilles de contact. La recherche d’Acanthamoeba par amplification génique (polymerase chain reaction [PCR]) était positive pour 40 % des kératites. L’examen en microscopie confocale in vivo retrouvait des images évocatrices de kystes amibiens dans 84 % des yeux étudiés. L’observation de ces kystes amibiens en microscopie confocale in vivo chez des patients ayant un prélèvement cornéen non contributif a permis d’orienter le diagnostic et d’expliquer partiellement l’évolution favorable sous traitement. L’examen de la cornée par cette méthode a également révélé la présence simultanée d’autres micro-organismes et de plusieurs cas de co-infections amibiennes et fongiques.

Conclusion

La microscopie confocale in vivo est un nouvel outil d’aide au diagnostic des kératites amibiennes, en particulier lorsque les prélèvements de cornée ne sont pas contributifs ou en cas de co-infection avec des éléments fongiques.

The full text of this article is available in PDF format.
Summary
Purpose

To study the usefulness of in vivo confocal microscopy imaging for the diagnosis of Acanthamoeba keratitis.

Methods

A retrospective review of 50 cases of Acanthamoeba keratitis followed at the Quinze-Vingts National Ophthalmology Hospital from January 2005 to July 2008 was conducted. Gender, age, contact lens wear, best-corrected visual acuity before and after treatment, slit-lamp examination findings, corneal scrapings for biological analysis, and in vivo confocal microscopy images were analyzed.

Results

Nearly 82 % of the cases of keratitis had a history of contact lens wear. Polymerase chain reaction (PCR) was positive for 40 % of the samples. Heidelberg Retinal Tomograph II-Rostock Cornea Module (HRTII-RCM) examination detected images evoking Acanthamoeba cyst-like images in 84 % of the cases. When the quality of biological samples was inadequate, the assessment of Acanthamoeba cysts using in vivo confocal microscopy made it possible to orient the diagnosis and to partially explain favorable progression under treatment. This technique showed images suggesting combined Acanthamoeba and fungal keratitis.

Conclusion

HRTII-RCM in vivo confocal microscopy is a non invasive and rapid technique that may be helpful for the diagnosis of Acanthamoeba keratitis, especially when laboratory testing is not contributive and when Acanthamoeba keratitis is combined with a fungal infection.

The full text of this article is available in PDF format.

Mots clés : Kératite amibienne, Acanthamoeba , Réaction en temps réel de polymérase en chaîne, Microscopie confocale in vivo

Keywords : In vivo confocal microscopy, Acanthamoeba keratitis, Real-time polymerase chain reaction


Introduction

Les kératites amibiennes sont des infections cornéennes rares, mais sévères [1]. Leur incidence jusqu’à très récemment croissante, était liée au port de lentilles de contact par des sujets ne respectant pas toujours les règles d’hygiène et d’entretien ou à des produits d’entretien avec des performances biocides insuffisantes [2]. Devant cette recrudescence, une alerte du Center for Disease Control and Prevention (CDP) a été lancée en 2007 [3].

Le diagnostic clinique des kératites amibiennes est parfois difficile tant la présentation de cette infection peut être polymorphe. Un diagnostic précoce et la mise en œuvre du traitement efficace demeurent les éléments majeurs du pronostic visuel [4]. L’examen diagnostique de référence est l’analyse biologique d’un prélèvement de cornée obtenu par grattage profond, pour examen direct, isolement par culture microbiologique et analyse en polymerase chain reaction (PCR) à la recherche du génome d’Acanthamoeba . Par une approche directe et non invasive, la microscopie confocale in vivo pourrait apporter une aide à la prise en charge de ces patients. L’objectif de cette étude était d’évaluer l’apport de la microscopie confocale in vivo pour le diagnostic des kératites amibiennes.

Matériel et méthodes
Patients

Les critères d’inclusion étaient des signes cliniques fortement évocateurs de kératite amibienne, la positivité d’au moins un des deux examens diagnostiques (PCR et/ou microscopie confocale in vivo) et l’efficacité clinique du traitement antiamibien. Des patients répondant aux critères cliniques et évolutifs, mais dont le résultat de la PCR était ininterprétable par manque de matériel biologique ont également été inclus.

Les dossiers de 50 cas de kératites suivis au Centre hospitalier national d’ophtalmologie des Quinze-Vingts entre janvier 2005 et juillet 2008 et répondant à ces critères ont été rétrospectivement étudiés.

Examen clinique

Tous les patients ont eu un examen ophtalmologique complet, avec une mesure de l’acuité visuelle au moment du diagnostic, au cours du suivi et à la fin du traitement. Plusieurs examens à la lampe à fente, quotidiens au départ, puis plus ou moins espacés en fonction de l’évolution ont été réalisés afin d’évaluer l’efficacité du traitement, de rechercher des signes de toxicité des traitements topiques et de diagnostiquer précocement les éventuelles complications (amincissement stromal, descemétoscèle, perforation, néovascularisation).

Examen microbiologique

Un grattage cornéen profond a été réalisé à la lampe à fente le plus précocement possible, dès la suspicion diagnostique pour tous les patients. Certains patients, adressés pour second avis, étaient déjà sous traitement à leur arrivée. Dans certains cas, une fenêtre thérapeutique de 48 heures a été réalisée avant le grattage cornéen. Les éléments du grattage ont tout d’abord été analysés par examen microscopique direct sur une lame après coloration de May-Grünwald-Giemsa afin de visualiser l’aspect cytologique et de rechercher des kystes et d’autres microorganismes.

Les prélèvements pour diagnostic par PCR en temps réel ont été obtenus par grattage cornéen profond avec des lames en acier inoxydable, puis mis dans des tubes sans ADN ni ARN et congelés immédiatement après. Les séquences pour les amorces pour la PCR ont été obtenues à partir du gène mitochondrial 41 591bp DNA d’Acanthamoeba castellanii , reconnaissant toutes les espèces disponibles à l’American Cell Type Collection (ATCC). Les séquences choisies étaient les suivantes : 5’GCACTCGCGGTAATACGA (amorce sens), 5’ACCACCTACGCACCCTTTACA (amorce anti-sens) et 6-FAM-AGTGTTATTCGCATTGACTGGGTGTAA-TAMRA (et sonde TaqMan®).

Cinq microlitres d’une suspension d’Herpes virus de phoque (phHV) (don de van Doornum, département de virologie Erasmus MC, Rotterdam, Pays-Bas) ont été ajoutés à 200 μl de chaque suspension d’échantillons avant l’extraction pour évaluer le rendement d’extraction et détecter de possibles inhibiteurs de PCR. Ensuite, 200 μl de tampon ATL (Qiagen, France) et 40 μl de protéinase K (Qiagen) ont été ajoutés et les suspensions ont été incubées à 56°C pendant dix minutes. La protéolyse a été arrêtée par chauffage à 95°C pendant dix minutes et l’ADN a été extrait par la technique MagNA Pure® (MagNA Pure LC-Roche), puis élué dans 100 μl. Les produits d’extraction obtenus ont été immédiatement refroidis à −20°C pendant cinq minutes, puis la température a été stabilisée à 20°C pendant 30minutes. La PCR en temps réel a été réalisée dans un volume final de 25 μl contenant le Mastermix 2X TaqMan® Fast Universal (2X, Applied Biosystems AB. Ref 4352042), les amorces sens et antisens d’Acanthamoeba , la sonde FAM-TAMRA Acanthamoeba , les amorces sens et antisens PhHV, la sonde PhHV-VIC-TAMRA et 12,5 μl d’ADN extrait dans de l’eau distillée.

L’amplification et la détection ont été réalisées avec le détecteur de séquence 7500 ABI Prism®. Le programme de cycles comprenait un cycle de 20 secondes à 95°C, 45 cycles de trois secondes à 95°C et enfin 30 secondes à 60°C. Les valeurs de Ct de chaque échantillon ont été déterminées en fonction de l’intensité de fluorescence dépassant le seuil de 0,07. Chaque série de tests incluait des contrôles négatifs ainsi que des standards avec un nombre de kystes connu. Un second test avec des aliquotes des mêmes extraits a été réalisé avec le SmartCyclerII® en 50 cycles en deux temps de dix secondes à 95°C et de 65 secondes à 60°C, après mélange de 12,5 μl d’ADN extrait avec 12,5 μl de 2X Master Mix TaqMan Universel SYBR Green (MNL 430 449 AB) contenant amorces sans sondes [5, 6, 7]. La quantification en parallèle des cellules épithéliales présentes dans chaque échantillon a permis d’évaluer la qualité du grattage cornéen.

S’ils étaient disponibles, les lentilles de contact ainsi que les boîtiers de lentilles ont été mis en culture après accord écrit des patients.

Suivant la présentation clinique, des cultures bactériennes et fongiques, des recherches des génomes viraux par PCR sur les grattages cornéens ont été réalisées.

Microscopie confocale in vivo

Tous les patients ont eu un examen en microscopie confocale in vivo [8] à la recherche d’images évocatrices de kystes amibiens. Cet examen a été réalisé avant l’instauration du traitement ou dans les 48 heures maximum après le début du traitement. Dans la mesure du possible, cet examen a été réalisé avant le grattage cornéen.

L’analyse en microscopie confocale in vivo de la cornée a été réalisée grâce au module cornéen du Heidelberg Retina Tomograph II-Rostock Cornea Module (HRT II-RCM, Heidelberg Engineering GmbH, Allemagne). Les images (384×384 pixels) correspondent à une surface de 400 μm×400 μm, soit une résolution digitale de 1 μm par pixel. La source laser est un laser diode de longueur d’onde 670 nm. L’ajustement de l’acquisition des images est contrôlé par une caméra CCD (480×460 pixels, RGB, 15 images/s) placée sur le côté de l’appareil, donnant une image latérale de l’œil du patient. L’appareil indique également la distance focale de l’image obtenue, permettant ainsi de connaître la profondeur en micromètres de la coupe observée. Une goutte anesthésique d’oxybuprocaïne 0,4 % ainsi qu’une goutte de gel lacrymal ont été instillées dans l’œil avant de réaliser l’examen. Aucune complication n’a été observée lors de la réalisation de cet examen.

Résultats
Patients

Cinquante yeux de 48 patients ont été examinés. L’âge moyen des patients était de 37,1 ans (17–77 ans), avec un ratio hommes/femmes de 0,3. Quarante-deux des 50 cas de kératites inclus portaient régulièrement des lentilles de contact souples. L’acuité visuelle moyenne au moment de l’inclusion était de 2,5/10e (de perception lumineuse positive à 10/10e). L’acuité visuelle finale était de 5,9/10e (de perception lumineuse positive à 10/10e). Deux patients ont été greffés (kératoplastie transfixiante) à distance de l’infection en raison d’opacités stromales résiduelles sur l’axe optique. Une greffe de membrane amniotique pour amincissement stromal a été nécessaire chez un patient.

Polymerase chain reaction Acanthamoeba

Le génome d’Acanthamoeba , retrouvé dans 20 prélevements (40 %), n’a pas été mis en évidence dans 24 prélèvements (48 %). Enfin, le résultat de la PCR était ininterprétable pour six yeux (12 %) (Tableau 1).

Microscopie confocale in vivo

La microscopie confocale in vivo des patients de notre étude a permis d’identifier deux types d’images qui pourraient correspondre aux deux formes d’Acanthamoeba . Les premières, très évocatrices de kystes, apparaissaient rondes, bien limitées, avec des parois à double contour, hyper-réflectives, de 15 à 20 μm de diamètre. Elles étaient situées le plus souvent dans l’épithélium cornéen (Figure 1, Figure 2) [9]. Quand ils étaient situés à l’intérieur de l’abcès, les kystes prenaient un aspect plus transparent, probablement en raison de la différence de densité des couches sous-jacentes.



Figure 1


Figure 1. 

Image de kyste en microscopie confocale in vivo.

Zoom



Figure 2


Figure 2. 

Kyste amibien en microcopie in vitro.

Zoom

Les seconds types d’images, mesurant de 15 à 45μm de diamètre, à contours irréguliers avec des aspects évocateurs de pseudopodes, et plus souvent situées dans le stroma cornéen, pourraient correspondre à des trophozoïtes d’Acanthamoeba (Figure 3, Figure 4).



Figure 3


Figure 3. 

Image évocatrice de trophozoïte en microscopie confocale in vivo (HRTII-RCM) avec pseudopodes bien visibles.

Zoom



Figure 4


Figure 4. 

A et B. Trophozoïtes en microscopie in vitro.

Zoom

Au total, des images pouvant être associées à l’une et/ou l’autre de ces descriptions ont été retrouvées dans 42 cas (84 %).

Comparaison des résultats retrouvés en polymerase chain reaction et en microscopie confocale in vivo

Les yeux ayant un résultat de PCR Acanthamoeba positif étaient au nombre de 20 sur les 50 inclus. Parmi ces 20 yeux, des images fortement évocatrices de kystes (Figure 5) et/ou de trophozoïtes amibiens (Figure 6) ont été trouvées en microscopie confocale in vivo dans 15 cas (soit 75 % des yeux avec PCR positive). Cet examen a donc confirmé le résultat positif de la PCR. En revanche, pour les cinq autres yeux avec un résultat de PCR Acanthamoeba positif (soit 25 % de ce groupe), aucune image d’infestation amibienne n’a été trouvée en microscopie confocale in vivo malgré des signes cliniques typiques de kératite amibienne et une évolution favorable sous un traitement antiamibien adapté.



Figure 5


Figure 5. 

A et B. Nombreuses structures rondes, hyper-réflectives à double contour évoquant un aspect de kystes d’Acanthamoeba en microscopie confocale in vivo (HRTII-RCM).

Zoom



Figure 6


Figure 6. 

A–C. Images à contours irréguliers dans le stroma cornéen évocatrices de trophozoïtes d’Acanthamoeba en microcopie confocale in vivo (HRTII-RCM).

Zoom

La PCR Acanthamoeba s’est révélée négative pour 24 yeux parmi les 50 inclus (48 %) (Figure 7). Conformément aux critères d’inclusion (présentation clinique caractéristique de kératite amibienne, réponse favorable au traitement antiamibien et positivité d’au moins un des deux examens diagnostiques), tous ces cas montraient des images évocatrices de kystes amibiens en microscopie confocale in vivo.



Figure 7


Figure 7. 

Concordance des résultats (en pourcentages) entre la polymerase chain reaction et la microscopie confocale in vivo réalisée à l’aide du HRTII-RCM. Dans 30 % des cas, les résultats de la PCR et de l’examen en HRT étaient tous les deux positifs. Dans 84 % des cas, l’examen en microscopie confocale in vivo a retrouvé des images évocatrices de kystes ou de trophozoïtes.

Zoom

Enfin, la PCR était ininterprétable dans six yeux (12 % des cas inclus) en raison d’un prélèvement de qualité insuffisante (absence de cellules dans l’échantillon) ou de la présence d’inhibiteurs de PCR. Dans trois de ces cas, des images caractéristiques de kystes amibiens ont été trouvées en microscopie confocale in vivo. Dans les trois autres cas, aucune image évocatrice d’infection amibienne n’a été détectée en microscopie confocale in vivo, mais ces patients présentaient tous des signes cliniques très fortement évocateurs d’une infection amibienne (douleur intense, abcès cornéen avec anneau œdémateux, kératonévrite…) et une évolution favorable a été observée sous traitement antiamibien.

Au total, sur l’ensemble de la série, des résultats concordants (positivité des deux examens) ont été retrouvés pour 15 yeux (30 %).

Présence simultanée d’autres micro-organismes

Pour plusieurs cas, d’autres micro-organismes ont été mis en évidence. La présence simultanée de bactéries sur le prélèvement cornéen a été mise en évidence dans 15 yeux. Les agents isolés étaient Staphylococcus epidermidis , Staphylococcus aureus , Propionibacterium acnes et Pseudomonas aeruginosa . Pour six de ces 15 yeux, un abcès d’allure bactérienne était présent et le recours à une trithérapie antibiotique contenant des collyres fortifiés a été nécessaire. Dans un des yeux présentant une co-infection amibes-bactérie, un hypopion était présent.

Aucun cas de co-infection amibes-virus n’a été mis en évidence.

L’examen de la cornée par microscopie confocale in vivo a également révélé, chez cinq patients, des images évocatrices de kystes amibiens associées à des éléments allongés pouvant être évocateurs de filaments mycéliens (Figure 8). L’ensemble des cultures fongiques effectuées sur les prélèvements cornéens de ces patients se sont révélées négatives, probablement en raison de traitements antiseptiques appliqués auparavant. Cependant, des filaments ont été mis en évidence par culture sur le boîtier et les lentilles d’un des patients. La PCR Acanthamoeba est revenue positive pour un seul de ces patients.



Figure 8


Figure 8. 

Image évocatrice d’hyphes de filaments mycéliens en microscopie confocale in vivo réalisée à l’aide du HRTII-RCM.

Zoom

Discussion

Les Acanthamoeba font partie des amibes libres, protozoaires ubiquitaires omniprésents dans l’environnement, notamment dans l’eau. Dans la nature, les Acanthamoeba se présentent sous deux formes, le trophozoïte, forme réplicative, et le kyste, forme de résistance. En réponse à un environnement où à des conditions défavorables, le trophozoïte se transforme en kyste protégé par une double paroi.

La PCR n’est réalisée que dans quelques centres. Sa sensibilité est proche de 85 % [5, 6]. Toutefois, dans notre étude, si la microscopie confocale avait été prise comme la référence (gold standard ) la sensibilité de la PCR serait de 40 %. Sans prendre en compte la mauvaise qualité de certains grattages cornéens (nombre de cellules insuffisantes ou présence d’un inhibiteur), ce chiffre peut aussi être expliqué par le fait qu’une partie des patients inclus étaient adressés après une longue période d’errance diagnostique avec des multiples traitements préalables. De plus, certains agents comme la fluorescéine, le rose Bengale et les anesthésiques locaux, lorsqu’ils sont mal rincés, sont connus comme pouvant être des inhibiteurs de PCR et donc augmenter le taux de faux-négatifs. Les prélèvements étant réalisés au service des urgences, le rinçage précédant la réalisation du prélèvement a pu être insuffisant pour une partie des patients. Toutefois, cette hypothèse ne peut être retenue étant donné qu’un témoin d’extraction et d’amplification a été introduit dans chaque échantillon avant l’extraction de l’ADN.

Des grattages trop superficiels ne permettant pas de collecter une quantité suffisante de matériel représentatif du site de colonisation des amibes peuvent également être à l’origine de certains résultats négatifs [9].

Des images évocatrices de kystes amibiens ont déjà été décrites en microscopie confocale in vivo [10]. Dans la littérature, la recherche d’images de kystes amibiens en microscopie confocale in vivo a une sensibilité proche de 100 % et une spécificité de 84 % [11, 12]. Cette technique permet également de rechercher des images évocatrices de filaments mycéliens suggérant une infection fongique [13]. Notre étude montre que dans les cas où le prélèvement cornéen était non contributif et dont la PCR était négative ou ininterprétable (30 cas sur 50), l’observation d’images de kystes amibiens en microscopie confocale in vivo a permis d’évoquer un diagnostic.

Un des intérêts majeurs de l’examen en microscopie confocale in vivo est donc d’orienter le diagnostic quand les examens biologiques sont négatifs ou ininterprétables, même si l’examen microbiologique reste la seule technique permettant de confirmer le diagnostic.

Les cas de présence simultanée de micro-organismes d’espèces différentes découverts dans notre étude étaient relativement nombreux. Parmi ces cas, ceux dans lesquels des bactéries ont été retrouvés étaient de loin majoritaires.

La présence simultanée de deux micro-organismes peut être expliquée par plusieurs mécanismes. Il peut s’agir de co-infections véritables ou simplement de contaminations cornéennes sans manifestation pathogénique associée, c’est-à-dire sans symptomatologie ni recours nécessaire à un traitement spécifique (portage asymptomatique).

Les véritables co-infections comme les contaminations peuvent se produire au même moment par deux agents présents dans le même milieu contaminant. C’est le cas le plus probable pour les co-infections amibes-champignons chez les porteurs de lentilles.

Une autre hypothèse est la survenue d’une seconde contamination ou infection survenant sur un terrain lésé par une première infection cornéenne.

Par ailleurs, les amibes contiennent des bactéries (endosymbiont) qui peuvent être isolées lors de la culture des échantillons. Ce phénomène pourrait également expliquer les nombreux cas de kératites amibiennes pour lesquels des bactéries ont été retrouvées sans manifestation clinique et sans qu’un traitement antibactérien n’ait été nécessaire.

Enfin, on ne peut exclure que certains cas de mise en évidence de bactéries soient dus à des contaminations lors du prélèvement, en particulier, lorsqu’aucune symptomatologie bactérienne n’était présente.

Cinq cas ont été considérés par le clinicien qui les suivait comme des co-infections amibes-champignons puisqu’ils présentaient à la fois des images évocatrices de kystes amibiens et des images évocatrices de filaments et avaient répondu favorablement à un traitement combiné. À notre connaissance, un seul cas de co-infection amibes-champignons a été rapporté dans la littérature en microscopie confocale in vivo [14].

Conclusion

L’examen en microscopie confocale in vivo est un outil utile au diagnostic des kératites amibiennes en complément des méthodes de laboratoire dont la PCR. L’examen en microscopie confocale in vivo présente l’avantage d’être non-invasif, rapide et d’apporter un résultat immédiat. Des images évocatrices de kystes amibiens orientent fortement le diagnostic, permettent l’instauration précoce du traitement dans l’attente des résultats de laboratoire ou lorsque la PCR est négative ou ininterprétable, pouvant ainsi considérablement améliorer le pronostic visuel. Cet outil permet également de mettre en évidence des co-infections potentielles, en particulier fongiques, et d’en commencer rapidement le traitement.

En conclusion, la microscopie confocale in vivo constitue un apport intéressant, complémentaire des examens de laboratoire, pour le diagnostic des kératites amibiennes. D’autres études, en particulier prospectives, seront nécessaires pour confirmer les résultats de ce travail.

Conflit d’intérêt

Les auteurs n’ont aucun conflit d’intérêt.

Références

Bourcier T., Chaumeil C. Infections cornéennes : diagnostic et traitement  Paris: Elsevier (2004). 
Patel A., Hammersmith K. Contact lens-related microbial keratitis: recent outbreaks Curr Opin Ophthalmol 2008 ;  19 : 302-306 [cross-ref]
Centers for disease control and prevention. Acanthamoeba keratitis multiple states, 2005–2007. MMWR Morb Mortal Wkly Rep 2007;56:532–4.
Tu E.Y., Joslin C.E., Sugar J., Shoff M.E., Booton G.C. Prognostic factors affecting visual outcome in Acanthamoeba keratitis Ophthalmology 2008 ;  115 : 1998-2003 [cross-ref]
Zamfir O., Yera H., Bourcier T., Batellier L., Dupouy-Camet J., Tourte-Schaeffer C., and al. Diagnostic par PCR des kératites à Acanthamoeba spp J Fr Ophtalmol 2006 ;  29 : 1034-1040 [inter-ref]
Mathers W.D., Nelson S.E., Lane J.L., Wilson M.E., Allen R.C., Folberg R. Confirmation of confocal microscopy diagnosis of Acanthamoeba keratitis using polymerase chain reaction analysis Arch Ophthalmol 2000 ;  118 : 178-183
Goldschmidt P., Degorge S., Saint-Jean C., Yera H., Zekhnini F., Batellier L., and al. Resistance of Acanthamoeba to classic DNA extraction methods used for the diagnosis of corneal infections Br J Ophthalmol 2008 ;  92 : 112-115 [cross-ref]
Baudouin C., Labbé A., Dupas B. Imagerie de la surface oculaire par microscopie confocale : l’histologie sans prélèvement J Fr Ophtalmol 2008 ;  31 : 308-316 [inter-ref]
Labbé A., Khammari C., Dupas B., Gabison E., Brasnu E., Labetoulle M., and al. Contribution of in vivo confocal microscopy to the diagnosis and management of infectious keratitis Ocul Surf 2009 ;  7 : 41-52
Matsumoto Y., Dogru M., Sato E.A., Katono Y., Uchino Y., Shimmura S., and al. The application of in vivo confocal scanning laser microscopy in the management of Acanthamoeba keratitis Mol Vis 2007 ;  25 : 1319-1326
Bourcier T., Dupas B., Borderie V., Chaumeil C., Larricart P., Baudouin C., and al. Heidelberg retina tomograph II findings of Acanthamoeba keratitis Ocul Immunol Inflamm 2005 ;  13 : 487-492 [cross-ref]
Kanavi M.R., Javadi M., Yazdani S., Mirdehghanm S. Sensibility and specificity of confocal scan in the diagnosis of infectious keratitis Cornea 2007 ;  26 : 782-786
Brasnu E., Bourcier T., Dupas B., Brasnu E., Degorge S., Rodallec T., and al. In vivo confocal microscopy in fungal keratitis Br J Ophthalmol 2007 ;  91 : 588-591 [cross-ref]
Babu K., Murthy K.R. Combined fungal and Acanthamoeba keratitis: diagnosis by in vivo confocal microscopy Eye 2007 ;  21 : 271-272 [cross-ref]



© 2010  Elsevier Masson SAS. All Rights Reserved.
EM-CONSULTE.COM is registrered at the CNIL, déclaration n° 1286925.
As per the Law relating to information storage and personal integrity, you have the right to oppose (art 26 of that law), access (art 34 of that law) and rectify (art 36 of that law) your personal data. You may thus request that your data, should it be inaccurate, incomplete, unclear, outdated, not be used or stored, be corrected, clarified, updated or deleted.
Personal information regarding our website's visitors, including their identity, is confidential.
The owners of this website hereby guarantee to respect the legal confidentiality conditions, applicable in France, and not to disclose this data to third parties.
Close
Article Outline