Médecine

Paramédical

Autres domaines

Affiner les résultats
flechePar spécialité:Voir +Voir -
  • Médecine interne (9782)
  • Imagerie médicale (9123)
  • Pédiatrie (8286)
  • Biologie, Bactériologie, maladies infectieuses (7327)
  • Chirurgie, autres (7190)
  • Biologie (7185)
  • Urologie, Néphrologie (7147)
  • Neurologie, neuropsychologie (6728)
  • Endocrinologie, Nutrition, Métabolisme (6662)
  • Médecine générale (6516)
  • Psychiatrie (5929)
  • Infirmier(e) (4525)
  • Chirurgie orthopédique, Traumatologie (4502)
  • Chirurgie plastique (4168)
  • Médecine de rééducation (4141)
  • Dermatologie, Vénérologie (3902)
  • Cancérologie (3677)
  • Gynécologie, obstétrique, sage-femme (3610)
  • Rhumatologie, Podologie (3546)
  • Pneumologie (3131)
  • Cardiologie, Médecine vasculaire (2376)
  • Santé publique, épidémiologie (2331)
  • Auxiliaire de puériculture (2294)
  • Petite enfance (2294)
  • Psychologie/Psychothérapie (2150)
  • Chirurgie générale et digestive (2116)
  • Pharmacie (2111)
  • Anesthésie, Réanimation, Médecine d'urgence (2087)
  • Examens de laboratoire (1891)
  • Gastro-entérologie, Hépatologie (1876)
  • Oto-rhino-laryngologie (1783)
  • Algologie, Soins palliatifs (1651)
  • Ophtalmologie (1646)
  • Immunologie clinique (1533)
  • Toxicologie (1252)
  • Médecine du sport (1177)
  • Hématologie (1094)
  • Kinesitherapeuthe, Ostéopathe (1059)
  • Cadre de santé (1016)
  • Gériatrie (941)
  • Pharmacologie, Thérapeutique (877)
  • Médecine du travail (851)
  • Dentaire (789)
  • Autres sciences (754)
  • Aide-soignant(e) (548)
  • Orthophoniste (258)
  • Pédicure Podologue (233)
  • Médecine légale (170)
  • Vétérinaire (169)
  • Psychomotricien (151)
  • Médecines complémentaires (140)
  • Anatomie (128)
  • Orthoptiste (107)
  • Audioprothésiste (4)
Ok
flechePar produit:Voir +Voir -
  • Archives de pédiatrie (5275)
  • Urologie (4866)
  • Journal de Gynécologie Obstétrique et Biologie de la Reproduction (4587)
  • Biomedicine and pharmacotherapy (4127)
  • Annales de Dermatologie et de Vénéréologie (3387)
  • Revue Neurologique (3159)
  • Journal de radiologie (2766)
  • La Presse Médicale (2702)
  • Diabetes & Metabolism (2577)
  • La revue de médecine interne (2457)
  • Annales d'Endocrinologie (2353)
  • Gastroentérologie Clinique et Biologique (1907)
  • AKOS (Traité de Médecine) (1487)
  • Annales médico-psychologiques (1394)
  • Revue des Maladies Respiratoires (1362)
  • Joint Bone Spine (1274)
  • Journal Français d'Ophtalmologie (1268)
  • Annales de Pathologie (1232)
  • Gynécologie Obstétrique & Fertilité (1216)
  • L'Encéphale (1203)
  • Comptes Rendus Mathématique (1153)
  • Neuropsychiatrie de l'Enfance et de l'adolescence (1124)
  • Revue du rhumatisme (1083)
  • Neurochirurgie (1031)
  • Journal of Neuroradiology (910)
  • Revue d'Epidémiologie et de Santé Publique (888)
  • Progrès en Urologie (881)
  • European Geriatric Medicine (881)
  • Médecine et maladies infectieuses (862)
  • Métiers de la petite enfance (845)
  • Revue Française d'Allergologie (809)
  • Journal de pédiatrie et de puériculture (808)
  • Annals of Physical and Rehabilitation Medicine (774)
  • Pédiatrie - Maladies infectieuses (762)
  • Cahiers de la puéricultrice (729)
  • Comptes Rendus Biologies (728)
  • Soins Pédiatrie/Puériculture (720)
  • Comptes Rendus Chimie (690)
  • Imagerie de la Femme (689)
  • Journal de Chirurgie Viscérale (681)
  • Revue de Chirurgie Orthopédique et Traumatologique (675)
  • Revue Française des Laboratoires (662)
  • Annales Françaises d'Oto-Rhino-Laryngologie et de pathologie cervico-faciale (662)
  • Archives des Maladies Professionnelles et de l'Environnement (650)
  • Actualités pharmaceutiques (609)
  • Psychiatrie (608)
  • Annales françaises d'anesthésie et de réanimation (582)
  • Clinics and Research in Hepatology and Gastroenterology (581)
  • RFL - Revue francophone des laboratoires (575)
  • Bulletin de l'Académie Nationale de Médecine (564)
  • Archives of cardiovascular diseases (550)
  • Neurophysiologie Clinique / Clinical Neurophysiology (544)
  • Diagnostic and Interventional Imaging (534)
  • Soins (532)
  • Neurologie (529)
  • Comptes Rendus Palevol (527)
  • Vocation Sage-femme (509)
  • Feuillets de Radiologie (507)
  • Geobios (493)
  • NPG (491)
  • L'évolution psychiatrique (475)
  • La revue Sage-femme (469)
  • La revue de l'infirmière (464)
  • Appareil locomoteur (463)
  • Sexologies (451)
  • Transfusion clinique et biologique (447)
  • European Annals of Otorhinolaryngology, Head and Neck Diseases  (446)
  • Médecine des maladies Métaboliques (441)
  • Néphrologie & Thérapeutique (440)
  • Pathologie Biologie (440)
  • Bulletin du Cancer (433)
  • Cahiers de Nutrition et de Diététique (419)
  • Médecine Nucléaire (413)
  • Option Bio (410)
  • Revue de Pneumologie Clinique (405)
  • Douleurs (401)
  • Orthopaedics & Traumatology: Surgery & Research (398)
  • Médecine palliative (395)
  • Cancer / Radiothérapie (390)
  • Soins Gérontologie (384)
  • Endocrinologie-Nutrition (380)
  • RADIOLOGIE ET IMAGERIE MÉDICALE : Musculosquelettique - Neurologique - Maxillofaciale (375)
  • Archives of Cardiovascular Diseases Supplements (373)
  • Oto-rhino-laryngologie (373)
  • Journal des Maladies Vasculaires (367)
  • Soins Psychiatrie (365)
  • Annales de chirurgie plastique esthétique (363)
  • L'aide-soignante (362)
  • Droit, déontologie et soin (354)
  • Annales de cardiologie et d'angéiologie (352)
  • Revue des Maladies Respiratoires Actualités (347)
  • Obstétrique (342)
  • Journal of visceral surgery (331)
  • Dermatologie (326)
  • Ophtalmologie (325)
  • Nutrition clinique et métabolisme (324)
  • Cardiologie (323)
  • Journal de Mycologie Médicale (322)
  • Le praticien en anesthésie réanimation (318)
  • Gastro-entérologie (316)
  • Annales de chirurgie (312)
  • Revue de Stomatologie et de Chirurgie Maxillo-Faciale (310)
  • Gynécologie (309)
  • Sociologie du travail (303)
  • Journal of Gynecology Obstetrics and Human Reproduction (300)
  • Gynécologie Obstétrique Fertilité & Sénologie (298)
  • Comptes Rendus Physique (284)
  • Maladies infectieuses (277)
  • Chirurgie de la main (273)
  • Pratique neurologique - FMC (272)
  • Ortho Magazine (258)
  • Hépatologie (251)
  • Biologie médicale (249)
  • Pratiques psychologiques (245)
  • Ethique & Santé (235)
  • Alter - European Journal of Disability research (235)
  • Journal de Thérapie Comportementale et Cognitive (234)
  • RADIOLOGIE ET IMAGERIE MÉDICALE : Abdominale - Digestive (234)
  • Science & Sports (231)
  • Journal de réadaptation médicale (222)
  • Therapies (216)
  • RADIOLOGIE ET IMAGERIE MÉDICALE : Cardiovasculaire - Thoracique - Cervicale (216)
  • Hématologie (214)
  • Pneumologie (213)
  • Ethics, Medicine and Public Health - Ethique, Médecine et Politiques Publiques (210)
  • Kinésithérapie, la revue (208)
  • Archives des maladies du coeur et des vaisseaux Pratique (208)
  • Anesthésie-Réanimation (207)
  • Chirurgie orale et maxillo-faciale (205)
  • Journal de Radiologie diagnostique et interventionnelle (202)
  • Urgences (202)
  • La revue de santé scolaire et universitaire (202)
  • Annales de réadaptation et de médecine physique (201)
  • Journal Europeen des Urgences (198)
  • Réanimation (198)
  • Annales Pharmaceutiques Françaises (188)
  • Médecine d'urgence (188)
  • Revue du Rhumatisme monographies (187)
  • RADIOLOGIE ET IMAGERIE MÉDICALE : Génito-urinaire - Gynéco-obstétricale - Mammaire (187)
  • Soins Aides-Soignantes (186)
  • European Review of Applied Psychology (182)
  • IRBM (177)
  • Comptes Rendus Mécanique (177)
  • Médecine du Sommeil (174)
  • Pédopsychiatrie (172)
  • Kinésithérapie-Médecine physique-Réadaptation (172)
  • Médecine & droit (170)
  • Journal de Traumatologie du Sport (166)
  • Techniques chirurgicales - Appareil digestif (163)
  • Journal of Stomatology Oral and Maxillofacial Surgery (160)
  • Toxicologie Analytique et Clinique (159)
  • Anaesthesia Critical Care & Pain Medicine (159)
  • Savoirs et soins infirmiers (158)
  • Médecine buccale (156)
  • Motricité cérébrale (151)
  • Pathologie professionnelle et de l'environnement (149)
  • Vétérinaire (147)
  • Annales d'urologie (146)
  • Revue d'Homéopathie (139)
  • Pratiques en nutrition (138)
  • Podologie (135)
  • Néphrologie (134)
  • Soins Cadres (130)
  • Morphologie (128)
  • Angéiologie (126)
  • Comptes Rendus Géoscience (124)
  • Odontologie (119)
  • Psychologie française (118)
  • Traité d'obstétrique  (116)
  • Antibiotiques (113)
  • Inter bloc (110)
  • Anesthésie & Réanimation (108)
  • Revue Francophone d'Orthoptie (107)
  • Netter. Précis de médecine interne (106)
  • Techniques chirurgicales - Thorax (102)
  • Hand Surgery and Rehabilitation (99)
  • Progrès en urologie-FMC (98)
  • European Journal of Trauma & Dissociation (96)
  • Revue de Stomatologie, de Chirurgie Maxillo-Faciale et de Chirurgie Orale (93)
  • Techniques chirurgicales - Urologie (90)
  • Journal Européen des Urgences et de Réanimation (86)
  • Techniques chirurgicales - Tête et cou (85)
  • Le Pharmacien Hospitalier et Clinicien (80)
  • Revue de Médecine légale (78)
  • Biomedicine and Preventive Nutrition (77)
  • Journal De Médecine Vasculaire (72)
  • Réanimation médicale  (71)
  • Journal d'Echographie et de Médecine par Ultrasons (70)
  • Techniques chirurgicales - Orthopédie-Traumatologie (66)
  • Oxymag (65)
  • Cosmétologie et Dermatologie esthétique (63)
  • Techniques chirurgicales - Chirurgie plastique reconstructrice et esthétique (62)
  • Journal d'imagerie diagnostique et interventionnelle (59)
  • Current Research in Translational Medicine (58)
  • Techniques chirurgicales - Gynécologie (55)
  • Techniques chirurgicales - Chirurgie vasculaire (54)
  • Psychologie du Travail et des Organisations (52)
  • Revue du Soignant en santé publique (47)
  • Archives des maladies du coeur et des vaisseaux (45)
  • L'Anthropologie (40)
  • IRBM News (36)
  • Les uvéites (34)
  • Pédiatrie (33)
  • Orthopédie dentofaciale (30)
  • 38e Congrès de la Société de réanimation de langue française (29)
  • Pratique medicale et chirurgicale de l'animal de compagnie (26)
  • Traité de médecine vasculaire. Tome 2 (25)
  • Congrès national d'anesthésie et de réanimation 2009 (24)
  • Les maladies de la Thyroïde (22)
  • Revue Francophone de Cicatrisation (21)
  • Pratique de l'accouchement (19)
  • Diabétologie (18)
  • RADIOLOGIE ET IMAGERIE MÉDICALE : Principes et techniques - Radioprotection (17)
  • Le sommeil de l'enfant (16)
  • La Presse médicale Formation (15)
  • Échographie en pratique obstétricale (14)
  • Les infirmités motrices cérébrales (13)
  • Maladies du sein (12)
  • Podologie (11)
  • Pneumologie pédiatrique : guide pratique (10)
  • Imagerie cardiaque : scanner et IRM (9)
  • 60 ordonnances alimentaires (8)
  • Conférences d'enseignement 2011, volume 100 (7)
  • JCC Open (6)
  • Complications et séquelles des traitements en cancérologie ORL  (5)
  • Audiologie pratique (4)
  • Orthèses de la main et du poignet (3)
  • Traitement des ruptures de la coiffe des rotateurs (2)
  • Précis d'acupuncture médicale occidentale (1)
Ok
flechePar type de produits:
  • Revues (62757)
  • Livres (35945)
  • Traités EMC (12019)
Ok
flechePar année:Voir +Voir -
  • 2020 (1707)
  • 2019 (4548)
  • 2018 (5444)
  • 2017 (5803)
  • 2016 (6017)
  • 2015 (6319)
  • 2014 (6437)
  • 2013 (6106)
  • 2012 (5281)
  • 2011 (5620)
  • 2010 (5583)
  • 2009 (6293)
  • 2008 (6732)
  • 2007 (5327)
  • 2006 (6662)
  • 2005 (4361)
  • 2004 (4336)
  • 2003 (4122)
  • 2002 (3522)
  • 2001 (2726)
  • 2000 (2350)
  • 1999 (1986)
  • 1998 (1895)
  • 1997 (1048)
  • 1996 (487)
  • 1995 (388)
  • 1994 (287)
  • 1993 (229)
  • 1992 (156)
  • 1991 (116)
  • 1990 (111)
  • 1989 (58)
  • 1988 (25)
  • 1987 (13)
  • 1986 (16)
  • 1985 (8)
  • 1984 (5)
  • 1983 (5)
  • 1982 (3)
  • 1981 (7)
  • 1980 (1)
  • 1978 (1)
  • 1975 (3)
  • 1955 (3)
Ok
flecheAvec compléments:Voir +Voir -
  • Iconographies (54527)
  • Autoévaluations (5569)
  • Autre (3081)
  • Arbres décisionnels (1339)
  • Informations supp. (1092)
  • Vidéos Animations (501)
  • Cas clinique (448)
  • Info patient (311)
  • Au quotidien (135)
  • Documents légaux (71)
Ok
flechePar langue:
  • Français (87958)
  • Anglais (24667)
Ok

Vous avez recherché :

Benign familial neonatal seizures

dans Tout le texte

Créer une alerte email
Modifier ma recherche
  • 112625 Résultats
  • Afficher :
  • Trier par :
  • Page : /11263 fleche suivante
    • 1
    • 2011
      • Convulsions infantiles bénignes familiales et non familiales : une entité homogène ? 
        Description of seizures depending on familial or non-familial epilepsy. ... Convulsions infantiles bénignes Familiales Non familiales Nombre de patients 14 (10 familles ... Clinical features, EEG and outcome of children with benign infantile seizures. ... Mémoire Convulsions infantiles bénignes familiales et non familiales : une entité homogène ? ... Familial and non-familial benign infantile seizures: A homogeneous entity? E. ...
      • Revue Neurologique
      • E. Bourel-Ponchel, A.-G. Le Moing, A. Delignières, A. De Broca, F. Wallois, P. Berquin
      • fleche fermerRésumé fleche fermerRésumé fleche ouvertPlan fleche ouvertPlan Ajouter à ma bibliothèque Retirer bibliothèque
    • 2
    • 2013
      • Convulsions néonatales révélant une hypomagnésémie congénitale familiale 
        Fait clinique Convulsions néonatales révélant une hypomagnésémie congénitale familiale Familial congenital ... hypomagnesemia revealed by neonatal convulsions M. ... Nous rapportons l’observation familiale de 3 enfants sénégalais issus d’un mariage consanguin, qui avaient ... présenté des convulsions néonatales et un retard des acquisitions psychomotrices. ... We report on three familial cases of congenital hypomagnesemia, two boys and one girl who belong to the ...
      • Archives de pédiatrie
      • M. Ndiaye, D.H. Toffa, A.-D. Sow, M.-S. Sène, A.-M. Basse, A.-L. Fall, L.-B. Seck, K. Touré, A.-G. Diop, H.-D. Sow, M.-M. Ndiaye
      • fleche fermerRésumé fleche fermerRésumé fleche ouvertPlan fleche ouvertPlan Ajouter à ma bibliothèque Retirer bibliothèque  Iconographies 
    • 3
    • 2019
      • Convulsions néonatales (à propos de 96 cas) 
        -7983(19)30096-9 10.1016/j.jpp.2019.06.008 Elsevier Masson SAS Article original Convulsions néonatales ... (à propos de 96 cas) Neonatal seizures (about 96 cases) W. ... Atmani a b a Service de néonatologie et réanimation néonatale, CHU Hassan II, Fès 30000, Maroc ... Service de néonatologie et réanimation néonatale, CHU Hassan II Fès 30000 Maroc b Université ... , hospitalisés au service de néonatologie et réanimation néonatale du CHU Hassan II de Fès, durant la ...
      • Journal de pédiatrie et de puériculture
      • W. Kojmane, F. Hmami, S. Atmani
      • fleche fermerRésumé fleche fermerRésumé fleche ouvertPlan fleche ouvertPlan Ajouter à ma bibliothèque Retirer bibliothèque
    • 4
    • 2004
      • Forme familiale bénigne de maladie de Degos 
        Forme familiale bénigne de maladie de Degos Forme familiale bénigne de maladie de Degos A. ... Les formes bénignes sont rares ou sous rapportées. Les formes familiales sont exceptionnelles. ... L'observation exceptionnelle d'une forme bénigne familiale fait discuter une prédisposition génétique ... Benign familial Degos disease. A.-L. Pinault A. Barbaud F. Weber-Muller J.-L. ... Benign forms are rare or under-reported and the familial forms are exceptional. ...
      • Annales de Dermatologie et de Vénéréologie
      • A.-L. Pinault, A. Barbaud, F. Weber-Muller, J.-L. Schmutz
      • fleche fermerRésumé fleche fermerRésumé fleche ouvertPlan fleche ouvertPlan Ajouter à ma bibliothèque Retirer bibliothèque  Iconographies 
    • 5
    • 2016
      • Severe neonatal seizures: From molecular diagnosis to precision therapy? 
        Epilepsy Severe neonatal seizures: From molecular diagnosis to precision therapy? M. ... Keywords Early epileptic encephalopathies Severe neonatal seizures EEE genes 1 Introduction ... nature of epilepsy, it is very difficult to determine whether the developmental disorder is secondary to seizure ... activity (seizures and interictal activities) or to genetic abnormality by itself (mutation in an ion ... The AED has a greater or lesser effect on seizure frequency, but do not change drastically the long-term ...
      • Revue Neurologique
      • M. Milh, P. Cacciagli, C. Ravix, C. Badens, A. Lépine, N. Villeneuve, L. Villard
      • fleche fermerRésumé fleche fermerRésumé fleche ouvertPlan fleche ouvertPlan Ajouter à ma bibliothèque Retirer bibliothèque  Iconographies 
    • 6
    • 1999
      • Benign neonatal familial convulsions: a model for the study of idiopathic epilepsies 
        Benign neonatal familial convulsions: a model for the study of idiopathic epilepsies E. ... Marescaux Benign neonatal familial convulsions : a model for the study of idiopathicepilepsies ... ______________________Benign neonatal famikial convulsions ( BNFC) have been iden Benign neonatal ... familial convulsions: a model for the study of idiopathic epilepsies. ... Revue Neurologique 1999; 155; 6-7: 463 Benign neonatal familial convulsions (BNFC) were identified ...
      • Revue Neurologique
      • E. Hirsch, A. de Saint-Martin, C. Marescaux
      • fleche ouvertPlan fleche ouvertPlan Ajouter à ma bibliothèque Retirer bibliothèque Version française Article gratuit
    • Accédez au résumé
    • 7
    • 1999
      • Benign neonatal familial convulsions: a model for the study of idiopathic epilepsies 
        Benign neonatal familial convulsions: a model for the study of idiopathic epilepsies E. ... Marescaux Benign neonatal familial convulsions : a model for the study of idiopathicepilepsies ... ______________________Benign neonatal famikial convulsions ( BNFC) have been iden Benign neonatal ... familial convulsions: a model for the study of idiopathic epilepsies. ... Revue Neurologique 1999; 155; 6-7: 463 Benign neonatal familial convulsions (BNFC) were identified ...
      • Revue Neurologique
      • E. Hirsch, A. de Saint-Martin, C. Marescaux
      • fleche ouvertPlan fleche ouvertPlan Ajouter à ma bibliothèque Retirer bibliothèque Version française Article gratuit
    • Accédez au résumé
    • 8
    • 2005
      • Du syndrome d'Alport à l'hématurie familiale bénigne : aspects cliniques et génétiques 
        Mise au point Du syndrome d'Alport à l'hématurie familiale bénigne : aspects cliniques et génétiques ... From Alport syndrome to benign familial hematuria: clinical and genetic aspect Nicolas Maziers ... familial hematuria (or healthy carrier state). ... Mots clés Syndrome d'Alport Hématurie familiale bénigne Membranes basales minces Néphropathie ... héréditaire Collagène de type IV Keywords Alport syndrome Benign familial hematuria Thin ...
      • Néphrologie & Thérapeutique
      • Nicolas Maziers, Karin Dahan, Yves Pirson
      • fleche fermerRésumé fleche fermerRésumé fleche ouvertPlan fleche ouvertPlan Ajouter à ma bibliothèque Retirer bibliothèque
    • 9
    • Sous presse

      2020
      • Biallelic mutations in DCDC2 cause neonatal sclerosing cholangitis in a Chinese family (Epreuves corrigées par l'auteur. Disponible en ligne depuis lesamedi 21 mars 2020)
        B: pedigree of this family, I-1 was the proband's father, I-2 was the proband's mother, II-1 was the ... GGAATGAATGGTGACCTTGAAGAG TGATCCAGAATCTCCTCGACTTG 60 Case reports Biallelic mutations in DCDC2 cause neonatal ... Highlights • We identified novel biallelic mutations in the DCDC2 gene causing neonatal sclerosing ... cholangitis (NSC) in a Chinese family. ... Summary Background Neonatal sclerosing cholangitis (NSC) is a severe cholestatic liver disease, which ...
      • Clinics and Research in Hepatology and Gastroenterology
      • Yuxiang Lin, Jianxing Zhang, Xiaoli Li, Dezhu Zheng, Xiurong Yu, Yichu Liu, Fenghua Lan, Zhihong Wang
      • fleche fermerRésumé fleche fermerRésumé fleche ouvertPlan fleche ouvertPlan Ajouter à ma bibliothèque Retirer bibliothèque  Iconographies 
    • Accédez au résumé
  • 112625 Résultats
  • Afficher :
  • Trier par :
  • Page : /11263 fleche suivante

Veuillez entrer au minimum 3 caractères.
;

Mon compte


Plateformes Elsevier Masson

Déclaration CNIL

EM-CONSULTE.COM est déclaré à la CNIL, déclaration n° 1286925.

En application de la loi nº78-17 du 6 janvier 1978 relative à l'informatique, aux fichiers et aux libertés, vous disposez des droits d'opposition (art.26 de la loi), d'accès (art.34 à 38 de la loi), et de rectification (art.36 de la loi) des données vous concernant. Ainsi, vous pouvez exiger que soient rectifiées, complétées, clarifiées, mises à jour ou effacées les informations vous concernant qui sont inexactes, incomplètes, équivoques, périmées ou dont la collecte ou l'utilisation ou la conservation est interdite.
Les informations personnelles concernant les visiteurs de notre site, y compris leur identité, sont confidentielles.
Le responsable du site s'engage sur l'honneur à respecter les conditions légales de confidentialité applicables en France et à ne pas divulguer ces informations à des tiers.